ID: 1190487841

View in Genome Browser
Species Human (GRCh38)
Location X:50946446-50946468
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190487835_1190487841 1 Left 1190487835 X:50946422-50946444 CCTGTTCAAATACAGTAGTCCCC No data
Right 1190487841 X:50946446-50946468 CATTATGTGCAGTTTTTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190487841 Original CRISPR CATTATGTGCAGTTTTTCCA TGG Intergenic
No off target data available for this crispr