ID: 1190491223

View in Genome Browser
Species Human (GRCh38)
Location X:50984081-50984103
Sequence CCACACAGAGAGAAGGAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190491223_1190491232 19 Left 1190491223 X:50984081-50984103 CCTGACTCCTTCTCTCTGTGTGG No data
Right 1190491232 X:50984123-50984145 GAGCGGGAAGCGCTCTAGCAGGG No data
1190491223_1190491233 26 Left 1190491223 X:50984081-50984103 CCTGACTCCTTCTCTCTGTGTGG No data
Right 1190491233 X:50984130-50984152 AAGCGCTCTAGCAGGGACTCTGG No data
1190491223_1190491230 3 Left 1190491223 X:50984081-50984103 CCTGACTCCTTCTCTCTGTGTGG No data
Right 1190491230 X:50984107-50984129 CTGGGATTCAAGTTGCGAGCGGG No data
1190491223_1190491229 2 Left 1190491223 X:50984081-50984103 CCTGACTCCTTCTCTCTGTGTGG No data
Right 1190491229 X:50984106-50984128 CCTGGGATTCAAGTTGCGAGCGG No data
1190491223_1190491231 18 Left 1190491223 X:50984081-50984103 CCTGACTCCTTCTCTCTGTGTGG No data
Right 1190491231 X:50984122-50984144 CGAGCGGGAAGCGCTCTAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190491223 Original CRISPR CCACACAGAGAGAAGGAGTC AGG (reversed) Intergenic
No off target data available for this crispr