ID: 1190496268

View in Genome Browser
Species Human (GRCh38)
Location X:51031134-51031156
Sequence GCCTGAAGTCAGCAAGTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190496259_1190496268 13 Left 1190496259 X:51031098-51031120 CCAACTCAGCCACATTACTGCTC No data
Right 1190496268 X:51031134-51031156 GCCTGAAGTCAGCAAGTGGTGGG No data
1190496258_1190496268 16 Left 1190496258 X:51031095-51031117 CCTCCAACTCAGCCACATTACTG No data
Right 1190496268 X:51031134-51031156 GCCTGAAGTCAGCAAGTGGTGGG No data
1190496261_1190496268 4 Left 1190496261 X:51031107-51031129 CCACATTACTGCTCAAGAGGTCC No data
Right 1190496268 X:51031134-51031156 GCCTGAAGTCAGCAAGTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190496268 Original CRISPR GCCTGAAGTCAGCAAGTGGT GGG Intergenic
No off target data available for this crispr