ID: 1190497179

View in Genome Browser
Species Human (GRCh38)
Location X:51037847-51037869
Sequence TAGGAAAAGGATGAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190497164_1190497179 30 Left 1190497164 X:51037794-51037816 CCCAAAAGCAGGATTTGCAAAAC No data
Right 1190497179 X:51037847-51037869 TAGGAAAAGGATGAGGAGGAGGG No data
1190497165_1190497179 29 Left 1190497165 X:51037795-51037817 CCAAAAGCAGGATTTGCAAAACA No data
Right 1190497179 X:51037847-51037869 TAGGAAAAGGATGAGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190497179 Original CRISPR TAGGAAAAGGATGAGGAGGA GGG Intergenic
No off target data available for this crispr