ID: 1190500342

View in Genome Browser
Species Human (GRCh38)
Location X:51069978-51070000
Sequence ATCTACAGTGAGTCTTTTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190500342_1190500345 1 Left 1190500342 X:51069978-51070000 CCAACAAAAGACTCACTGTAGAT No data
Right 1190500345 X:51070002-51070024 CCAAAACACAAATAAGTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190500342 Original CRISPR ATCTACAGTGAGTCTTTTGT TGG (reversed) Intergenic
No off target data available for this crispr