ID: 1190500345

View in Genome Browser
Species Human (GRCh38)
Location X:51070002-51070024
Sequence CCAAAACACAAATAAGTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190500341_1190500345 21 Left 1190500341 X:51069958-51069980 CCATGATGAACTACATGCTTCCA No data
Right 1190500345 X:51070002-51070024 CCAAAACACAAATAAGTTGAAGG No data
1190500342_1190500345 1 Left 1190500342 X:51069978-51070000 CCAACAAAAGACTCACTGTAGAT No data
Right 1190500345 X:51070002-51070024 CCAAAACACAAATAAGTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190500345 Original CRISPR CCAAAACACAAATAAGTTGA AGG Intergenic
No off target data available for this crispr