ID: 1190500726

View in Genome Browser
Species Human (GRCh38)
Location X:51075514-51075536
Sequence CGGGCAAACAGTACTGGCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190500726_1190500734 1 Left 1190500726 X:51075514-51075536 CCAAAGCCAGTACTGTTTGCCCG No data
Right 1190500734 X:51075538-51075560 GGCCCACACAGTGACCCAGTGGG No data
1190500726_1190500740 23 Left 1190500726 X:51075514-51075536 CCAAAGCCAGTACTGTTTGCCCG No data
Right 1190500740 X:51075560-51075582 GAGCCCTCCCACAGACCTGGAGG No data
1190500726_1190500739 20 Left 1190500726 X:51075514-51075536 CCAAAGCCAGTACTGTTTGCCCG No data
Right 1190500739 X:51075557-51075579 TGGGAGCCCTCCCACAGACCTGG No data
1190500726_1190500733 0 Left 1190500726 X:51075514-51075536 CCAAAGCCAGTACTGTTTGCCCG No data
Right 1190500733 X:51075537-51075559 GGGCCCACACAGTGACCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190500726 Original CRISPR CGGGCAAACAGTACTGGCTT TGG (reversed) Intergenic
No off target data available for this crispr