ID: 1190500732

View in Genome Browser
Species Human (GRCh38)
Location X:51075534-51075556
Sequence CTGGGTCACTGTGTGGGCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190500732_1190500746 27 Left 1190500732 X:51075534-51075556 CCGGGGCCCACACAGTGACCCAG No data
Right 1190500746 X:51075584-51075606 AGCCACCCCTGTGTGTAACCAGG No data
1190500732_1190500740 3 Left 1190500732 X:51075534-51075556 CCGGGGCCCACACAGTGACCCAG No data
Right 1190500740 X:51075560-51075582 GAGCCCTCCCACAGACCTGGAGG No data
1190500732_1190500739 0 Left 1190500732 X:51075534-51075556 CCGGGGCCCACACAGTGACCCAG No data
Right 1190500739 X:51075557-51075579 TGGGAGCCCTCCCACAGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190500732 Original CRISPR CTGGGTCACTGTGTGGGCCC CGG (reversed) Intergenic
No off target data available for this crispr