ID: 1190500734

View in Genome Browser
Species Human (GRCh38)
Location X:51075538-51075560
Sequence GGCCCACACAGTGACCCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190500724_1190500734 22 Left 1190500724 X:51075493-51075515 CCAGCCTCTTTTATCTGCAGACC No data
Right 1190500734 X:51075538-51075560 GGCCCACACAGTGACCCAGTGGG No data
1190500726_1190500734 1 Left 1190500726 X:51075514-51075536 CCAAAGCCAGTACTGTTTGCCCG No data
Right 1190500734 X:51075538-51075560 GGCCCACACAGTGACCCAGTGGG No data
1190500725_1190500734 18 Left 1190500725 X:51075497-51075519 CCTCTTTTATCTGCAGACCAAAG No data
Right 1190500734 X:51075538-51075560 GGCCCACACAGTGACCCAGTGGG No data
1190500730_1190500734 -5 Left 1190500730 X:51075520-51075542 CCAGTACTGTTTGCCCGGGGCCC No data
Right 1190500734 X:51075538-51075560 GGCCCACACAGTGACCCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190500734 Original CRISPR GGCCCACACAGTGACCCAGT GGG Intergenic
No off target data available for this crispr