ID: 1190500740

View in Genome Browser
Species Human (GRCh38)
Location X:51075560-51075582
Sequence GAGCCCTCCCACAGACCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190500735_1190500740 -3 Left 1190500735 X:51075540-51075562 CCCACACAGTGACCCAGTGGGAG No data
Right 1190500740 X:51075560-51075582 GAGCCCTCCCACAGACCTGGAGG No data
1190500731_1190500740 4 Left 1190500731 X:51075533-51075555 CCCGGGGCCCACACAGTGACCCA No data
Right 1190500740 X:51075560-51075582 GAGCCCTCCCACAGACCTGGAGG No data
1190500736_1190500740 -4 Left 1190500736 X:51075541-51075563 CCACACAGTGACCCAGTGGGAGC No data
Right 1190500740 X:51075560-51075582 GAGCCCTCCCACAGACCTGGAGG No data
1190500730_1190500740 17 Left 1190500730 X:51075520-51075542 CCAGTACTGTTTGCCCGGGGCCC No data
Right 1190500740 X:51075560-51075582 GAGCCCTCCCACAGACCTGGAGG No data
1190500732_1190500740 3 Left 1190500732 X:51075534-51075556 CCGGGGCCCACACAGTGACCCAG No data
Right 1190500740 X:51075560-51075582 GAGCCCTCCCACAGACCTGGAGG No data
1190500726_1190500740 23 Left 1190500726 X:51075514-51075536 CCAAAGCCAGTACTGTTTGCCCG No data
Right 1190500740 X:51075560-51075582 GAGCCCTCCCACAGACCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190500740 Original CRISPR GAGCCCTCCCACAGACCTGG AGG Intergenic
No off target data available for this crispr