ID: 1190500746

View in Genome Browser
Species Human (GRCh38)
Location X:51075584-51075606
Sequence AGCCACCCCTGTGTGTAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190500744_1190500746 -7 Left 1190500744 X:51075568-51075590 CCACAGACCTGGAGGAAGCCACC No data
Right 1190500746 X:51075584-51075606 AGCCACCCCTGTGTGTAACCAGG No data
1190500737_1190500746 9 Left 1190500737 X:51075552-51075574 CCCAGTGGGAGCCCTCCCACAGA No data
Right 1190500746 X:51075584-51075606 AGCCACCCCTGTGTGTAACCAGG No data
1190500735_1190500746 21 Left 1190500735 X:51075540-51075562 CCCACACAGTGACCCAGTGGGAG No data
Right 1190500746 X:51075584-51075606 AGCCACCCCTGTGTGTAACCAGG No data
1190500736_1190500746 20 Left 1190500736 X:51075541-51075563 CCACACAGTGACCCAGTGGGAGC No data
Right 1190500746 X:51075584-51075606 AGCCACCCCTGTGTGTAACCAGG No data
1190500732_1190500746 27 Left 1190500732 X:51075534-51075556 CCGGGGCCCACACAGTGACCCAG No data
Right 1190500746 X:51075584-51075606 AGCCACCCCTGTGTGTAACCAGG No data
1190500743_1190500746 -6 Left 1190500743 X:51075567-51075589 CCCACAGACCTGGAGGAAGCCAC No data
Right 1190500746 X:51075584-51075606 AGCCACCCCTGTGTGTAACCAGG No data
1190500731_1190500746 28 Left 1190500731 X:51075533-51075555 CCCGGGGCCCACACAGTGACCCA No data
Right 1190500746 X:51075584-51075606 AGCCACCCCTGTGTGTAACCAGG No data
1190500741_1190500746 -2 Left 1190500741 X:51075563-51075585 CCCTCCCACAGACCTGGAGGAAG No data
Right 1190500746 X:51075584-51075606 AGCCACCCCTGTGTGTAACCAGG No data
1190500738_1190500746 8 Left 1190500738 X:51075553-51075575 CCAGTGGGAGCCCTCCCACAGAC No data
Right 1190500746 X:51075584-51075606 AGCCACCCCTGTGTGTAACCAGG No data
1190500742_1190500746 -3 Left 1190500742 X:51075564-51075586 CCTCCCACAGACCTGGAGGAAGC No data
Right 1190500746 X:51075584-51075606 AGCCACCCCTGTGTGTAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190500746 Original CRISPR AGCCACCCCTGTGTGTAACC AGG Intergenic
No off target data available for this crispr