ID: 1190501474

View in Genome Browser
Species Human (GRCh38)
Location X:51082891-51082913
Sequence CCTCACTCGCACCAAAGCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190501474_1190501476 -5 Left 1190501474 X:51082891-51082913 CCAATGCTTTGGTGCGAGTGAGG No data
Right 1190501476 X:51082909-51082931 TGAGGCTATGTTCCCAGTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190501474 Original CRISPR CCTCACTCGCACCAAAGCAT TGG (reversed) Intergenic
No off target data available for this crispr