ID: 1190510915

View in Genome Browser
Species Human (GRCh38)
Location X:51173536-51173558
Sequence ATGGGTTGGTGCCCTCTGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190510903_1190510915 19 Left 1190510903 X:51173494-51173516 CCTGGCAGGAGGGTTTGGGTCAT No data
Right 1190510915 X:51173536-51173558 ATGGGTTGGTGCCCTCTGCGTGG No data
1190510901_1190510915 21 Left 1190510901 X:51173492-51173514 CCCCTGGCAGGAGGGTTTGGGTC No data
Right 1190510915 X:51173536-51173558 ATGGGTTGGTGCCCTCTGCGTGG No data
1190510902_1190510915 20 Left 1190510902 X:51173493-51173515 CCCTGGCAGGAGGGTTTGGGTCA No data
Right 1190510915 X:51173536-51173558 ATGGGTTGGTGCCCTCTGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190510915 Original CRISPR ATGGGTTGGTGCCCTCTGCG TGG Intergenic
No off target data available for this crispr