ID: 1190512173

View in Genome Browser
Species Human (GRCh38)
Location X:51184901-51184923
Sequence TGTTGTGAGAGGATACAAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190512173_1190512181 17 Left 1190512173 X:51184901-51184923 CCCCTTTGTATCCTCTCACAACA No data
Right 1190512181 X:51184941-51184963 CATGGACAAAAGTCTCTTTGTGG No data
1190512173_1190512182 18 Left 1190512173 X:51184901-51184923 CCCCTTTGTATCCTCTCACAACA No data
Right 1190512182 X:51184942-51184964 ATGGACAAAAGTCTCTTTGTGGG No data
1190512173_1190512183 26 Left 1190512173 X:51184901-51184923 CCCCTTTGTATCCTCTCACAACA No data
Right 1190512183 X:51184950-51184972 AAGTCTCTTTGTGGGAACCTTGG No data
1190512173_1190512184 27 Left 1190512173 X:51184901-51184923 CCCCTTTGTATCCTCTCACAACA No data
Right 1190512184 X:51184951-51184973 AGTCTCTTTGTGGGAACCTTGGG No data
1190512173_1190512177 -1 Left 1190512173 X:51184901-51184923 CCCCTTTGTATCCTCTCACAACA No data
Right 1190512177 X:51184923-51184945 ACAAATTCTGCACCCATCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190512173 Original CRISPR TGTTGTGAGAGGATACAAAG GGG (reversed) Intergenic
No off target data available for this crispr