ID: 1190512174

View in Genome Browser
Species Human (GRCh38)
Location X:51184902-51184924
Sequence GTGTTGTGAGAGGATACAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190512174_1190512184 26 Left 1190512174 X:51184902-51184924 CCCTTTGTATCCTCTCACAACAC No data
Right 1190512184 X:51184951-51184973 AGTCTCTTTGTGGGAACCTTGGG No data
1190512174_1190512182 17 Left 1190512174 X:51184902-51184924 CCCTTTGTATCCTCTCACAACAC No data
Right 1190512182 X:51184942-51184964 ATGGACAAAAGTCTCTTTGTGGG No data
1190512174_1190512181 16 Left 1190512174 X:51184902-51184924 CCCTTTGTATCCTCTCACAACAC No data
Right 1190512181 X:51184941-51184963 CATGGACAAAAGTCTCTTTGTGG No data
1190512174_1190512183 25 Left 1190512174 X:51184902-51184924 CCCTTTGTATCCTCTCACAACAC No data
Right 1190512183 X:51184950-51184972 AAGTCTCTTTGTGGGAACCTTGG No data
1190512174_1190512177 -2 Left 1190512174 X:51184902-51184924 CCCTTTGTATCCTCTCACAACAC No data
Right 1190512177 X:51184923-51184945 ACAAATTCTGCACCCATCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190512174 Original CRISPR GTGTTGTGAGAGGATACAAA GGG (reversed) Intergenic