ID: 1190512176

View in Genome Browser
Species Human (GRCh38)
Location X:51184912-51184934
Sequence TGCAGAATTTGTGTTGTGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190512176_1190512182 7 Left 1190512176 X:51184912-51184934 CCTCTCACAACACAAATTCTGCA No data
Right 1190512182 X:51184942-51184964 ATGGACAAAAGTCTCTTTGTGGG No data
1190512176_1190512185 23 Left 1190512176 X:51184912-51184934 CCTCTCACAACACAAATTCTGCA No data
Right 1190512185 X:51184958-51184980 TTGTGGGAACCTTGGGATTCAGG No data
1190512176_1190512186 30 Left 1190512176 X:51184912-51184934 CCTCTCACAACACAAATTCTGCA No data
Right 1190512186 X:51184965-51184987 AACCTTGGGATTCAGGTAGAAGG No data
1190512176_1190512184 16 Left 1190512176 X:51184912-51184934 CCTCTCACAACACAAATTCTGCA No data
Right 1190512184 X:51184951-51184973 AGTCTCTTTGTGGGAACCTTGGG No data
1190512176_1190512183 15 Left 1190512176 X:51184912-51184934 CCTCTCACAACACAAATTCTGCA No data
Right 1190512183 X:51184950-51184972 AAGTCTCTTTGTGGGAACCTTGG No data
1190512176_1190512181 6 Left 1190512176 X:51184912-51184934 CCTCTCACAACACAAATTCTGCA No data
Right 1190512181 X:51184941-51184963 CATGGACAAAAGTCTCTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190512176 Original CRISPR TGCAGAATTTGTGTTGTGAG AGG (reversed) Intergenic
No off target data available for this crispr