ID: 1190512177

View in Genome Browser
Species Human (GRCh38)
Location X:51184923-51184945
Sequence ACAAATTCTGCACCCATCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190512174_1190512177 -2 Left 1190512174 X:51184902-51184924 CCCTTTGTATCCTCTCACAACAC No data
Right 1190512177 X:51184923-51184945 ACAAATTCTGCACCCATCCATGG No data
1190512173_1190512177 -1 Left 1190512173 X:51184901-51184923 CCCCTTTGTATCCTCTCACAACA No data
Right 1190512177 X:51184923-51184945 ACAAATTCTGCACCCATCCATGG No data
1190512175_1190512177 -3 Left 1190512175 X:51184903-51184925 CCTTTGTATCCTCTCACAACACA No data
Right 1190512177 X:51184923-51184945 ACAAATTCTGCACCCATCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190512177 Original CRISPR ACAAATTCTGCACCCATCCA TGG Intergenic
No off target data available for this crispr