ID: 1190512178

View in Genome Browser
Species Human (GRCh38)
Location X:51184935-51184957
Sequence AGAGACTTTTGTCCATGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190512178_1190512185 0 Left 1190512178 X:51184935-51184957 CCCATCCATGGACAAAAGTCTCT No data
Right 1190512185 X:51184958-51184980 TTGTGGGAACCTTGGGATTCAGG No data
1190512178_1190512186 7 Left 1190512178 X:51184935-51184957 CCCATCCATGGACAAAAGTCTCT No data
Right 1190512186 X:51184965-51184987 AACCTTGGGATTCAGGTAGAAGG No data
1190512178_1190512184 -7 Left 1190512178 X:51184935-51184957 CCCATCCATGGACAAAAGTCTCT No data
Right 1190512184 X:51184951-51184973 AGTCTCTTTGTGGGAACCTTGGG No data
1190512178_1190512188 23 Left 1190512178 X:51184935-51184957 CCCATCCATGGACAAAAGTCTCT No data
Right 1190512188 X:51184981-51185003 TAGAAGGTGTAACTCCTCAGTGG No data
1190512178_1190512183 -8 Left 1190512178 X:51184935-51184957 CCCATCCATGGACAAAAGTCTCT No data
Right 1190512183 X:51184950-51184972 AAGTCTCTTTGTGGGAACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190512178 Original CRISPR AGAGACTTTTGTCCATGGAT GGG (reversed) Intergenic
No off target data available for this crispr