ID: 1190512183

View in Genome Browser
Species Human (GRCh38)
Location X:51184950-51184972
Sequence AAGTCTCTTTGTGGGAACCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190512173_1190512183 26 Left 1190512173 X:51184901-51184923 CCCCTTTGTATCCTCTCACAACA No data
Right 1190512183 X:51184950-51184972 AAGTCTCTTTGTGGGAACCTTGG No data
1190512178_1190512183 -8 Left 1190512178 X:51184935-51184957 CCCATCCATGGACAAAAGTCTCT No data
Right 1190512183 X:51184950-51184972 AAGTCTCTTTGTGGGAACCTTGG No data
1190512176_1190512183 15 Left 1190512176 X:51184912-51184934 CCTCTCACAACACAAATTCTGCA No data
Right 1190512183 X:51184950-51184972 AAGTCTCTTTGTGGGAACCTTGG No data
1190512179_1190512183 -9 Left 1190512179 X:51184936-51184958 CCATCCATGGACAAAAGTCTCTT No data
Right 1190512183 X:51184950-51184972 AAGTCTCTTTGTGGGAACCTTGG No data
1190512175_1190512183 24 Left 1190512175 X:51184903-51184925 CCTTTGTATCCTCTCACAACACA No data
Right 1190512183 X:51184950-51184972 AAGTCTCTTTGTGGGAACCTTGG No data
1190512174_1190512183 25 Left 1190512174 X:51184902-51184924 CCCTTTGTATCCTCTCACAACAC No data
Right 1190512183 X:51184950-51184972 AAGTCTCTTTGTGGGAACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190512183 Original CRISPR AAGTCTCTTTGTGGGAACCT TGG Intergenic
No off target data available for this crispr