ID: 1190512186

View in Genome Browser
Species Human (GRCh38)
Location X:51184965-51184987
Sequence AACCTTGGGATTCAGGTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190512176_1190512186 30 Left 1190512176 X:51184912-51184934 CCTCTCACAACACAAATTCTGCA No data
Right 1190512186 X:51184965-51184987 AACCTTGGGATTCAGGTAGAAGG No data
1190512178_1190512186 7 Left 1190512178 X:51184935-51184957 CCCATCCATGGACAAAAGTCTCT No data
Right 1190512186 X:51184965-51184987 AACCTTGGGATTCAGGTAGAAGG No data
1190512179_1190512186 6 Left 1190512179 X:51184936-51184958 CCATCCATGGACAAAAGTCTCTT No data
Right 1190512186 X:51184965-51184987 AACCTTGGGATTCAGGTAGAAGG No data
1190512180_1190512186 2 Left 1190512180 X:51184940-51184962 CCATGGACAAAAGTCTCTTTGTG No data
Right 1190512186 X:51184965-51184987 AACCTTGGGATTCAGGTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190512186 Original CRISPR AACCTTGGGATTCAGGTAGA AGG Intergenic
No off target data available for this crispr