ID: 1190514537

View in Genome Browser
Species Human (GRCh38)
Location X:51209134-51209156
Sequence AAGGCTGCAGGGTAGAACTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190514529_1190514537 18 Left 1190514529 X:51209093-51209115 CCACTTAGGAAAACAAGTGTAAG No data
Right 1190514537 X:51209134-51209156 AAGGCTGCAGGGTAGAACTGAGG No data
1190514533_1190514537 -8 Left 1190514533 X:51209119-51209141 CCTACACCAGCGTGGAAGGCTGC No data
Right 1190514537 X:51209134-51209156 AAGGCTGCAGGGTAGAACTGAGG No data
1190514528_1190514537 23 Left 1190514528 X:51209088-51209110 CCAATCCACTTAGGAAAACAAGT No data
Right 1190514537 X:51209134-51209156 AAGGCTGCAGGGTAGAACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190514537 Original CRISPR AAGGCTGCAGGGTAGAACTG AGG Intergenic
No off target data available for this crispr