ID: 1190515335

View in Genome Browser
Species Human (GRCh38)
Location X:51218101-51218123
Sequence TGTTTTTTAGAGATGGAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190515333_1190515335 8 Left 1190515333 X:51218070-51218092 CCTGTAGTATAGTTTGTTTGTTG No data
Right 1190515335 X:51218101-51218123 TGTTTTTTAGAGATGGAGTCTGG No data
1190515331_1190515335 28 Left 1190515331 X:51218050-51218072 CCTGTTTTGGTCACTGTAGCCCT No data
Right 1190515335 X:51218101-51218123 TGTTTTTTAGAGATGGAGTCTGG No data
1190515332_1190515335 9 Left 1190515332 X:51218069-51218091 CCCTGTAGTATAGTTTGTTTGTT No data
Right 1190515335 X:51218101-51218123 TGTTTTTTAGAGATGGAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190515335 Original CRISPR TGTTTTTTAGAGATGGAGTC TGG Intergenic
No off target data available for this crispr