ID: 1190515832

View in Genome Browser
Species Human (GRCh38)
Location X:51222918-51222940
Sequence TGCAGCATAAGCAGCAGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190515829_1190515832 -5 Left 1190515829 X:51222900-51222922 CCAAGCAACACCAGTAACTGCAG No data
Right 1190515832 X:51222918-51222940 TGCAGCATAAGCAGCAGAGGTGG No data
1190515828_1190515832 9 Left 1190515828 X:51222886-51222908 CCTGGAGGCAGCTTCCAAGCAAC No data
Right 1190515832 X:51222918-51222940 TGCAGCATAAGCAGCAGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190515832 Original CRISPR TGCAGCATAAGCAGCAGAGG TGG Intergenic
No off target data available for this crispr