ID: 1190516790

View in Genome Browser
Species Human (GRCh38)
Location X:51232022-51232044
Sequence CTGGGACTTATGGGACTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190516782_1190516790 6 Left 1190516782 X:51231993-51232015 CCATAACACACTATGTGTGAAGC No data
Right 1190516790 X:51232022-51232044 CTGGGACTTATGGGACTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190516790 Original CRISPR CTGGGACTTATGGGACTTGA GGG Intergenic