ID: 1190516790 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:51232022-51232044 |
| Sequence | CTGGGACTTATGGGACTTGA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1190516782_1190516790 | 6 | Left | 1190516782 | X:51231993-51232015 | CCATAACACACTATGTGTGAAGC | No data | ||
| Right | 1190516790 | X:51232022-51232044 | CTGGGACTTATGGGACTTGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1190516790 | Original CRISPR | CTGGGACTTATGGGACTTGA GGG | Intergenic | ||