ID: 1190516998

View in Genome Browser
Species Human (GRCh38)
Location X:51234167-51234189
Sequence TTGGCTTTGAATATAGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190516995_1190516998 26 Left 1190516995 X:51234118-51234140 CCATGGTAGCAGAAGTCAAAGAA No data
Right 1190516998 X:51234167-51234189 TTGGCTTTGAATATAGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190516998 Original CRISPR TTGGCTTTGAATATAGAGGA AGG Intergenic
No off target data available for this crispr