ID: 1190519380

View in Genome Browser
Species Human (GRCh38)
Location X:51261869-51261891
Sequence TGTCTAATGAGACCAACATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190519380_1190519382 22 Left 1190519380 X:51261869-51261891 CCAGATGTTGGTCTCATTAGACA No data
Right 1190519382 X:51261914-51261936 AAATATATTCAAATAAGTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190519380 Original CRISPR TGTCTAATGAGACCAACATC TGG (reversed) Intergenic
No off target data available for this crispr