ID: 1190520661

View in Genome Browser
Species Human (GRCh38)
Location X:51276632-51276654
Sequence TAATCACCCACGGGGGGCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190520661_1190520671 -8 Left 1190520661 X:51276632-51276654 CCCCCGCCCCCCGTGGGTGATTA No data
Right 1190520671 X:51276647-51276669 GGTGATTATCGGATATCCTTTGG No data
1190520661_1190520672 -1 Left 1190520661 X:51276632-51276654 CCCCCGCCCCCCGTGGGTGATTA No data
Right 1190520672 X:51276654-51276676 ATCGGATATCCTTTGGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190520661 Original CRISPR TAATCACCCACGGGGGGCGG GGG (reversed) Intergenic
No off target data available for this crispr