ID: 1190522169

View in Genome Browser
Species Human (GRCh38)
Location X:51291566-51291588
Sequence CCATGCTATGCACTGTGTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190522169_1190522172 -3 Left 1190522169 X:51291566-51291588 CCTCTACACAGTGCATAGCATGG No data
Right 1190522172 X:51291586-51291608 TGGTTTTCAGCACACAAAAAGGG No data
1190522169_1190522171 -4 Left 1190522169 X:51291566-51291588 CCTCTACACAGTGCATAGCATGG No data
Right 1190522171 X:51291585-51291607 ATGGTTTTCAGCACACAAAAAGG No data
1190522169_1190522173 -2 Left 1190522169 X:51291566-51291588 CCTCTACACAGTGCATAGCATGG No data
Right 1190522173 X:51291587-51291609 GGTTTTCAGCACACAAAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190522169 Original CRISPR CCATGCTATGCACTGTGTAG AGG (reversed) Intergenic
No off target data available for this crispr