ID: 1190527882

View in Genome Browser
Species Human (GRCh38)
Location X:51346279-51346301
Sequence AGTTATATGCAGAGCATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190527880_1190527882 4 Left 1190527880 X:51346252-51346274 CCAAGAGCTATTTCTCAAAAGGA 0: 3
1: 33
2: 262
3: 261
4: 463
Right 1190527882 X:51346279-51346301 AGTTATATGCAGAGCATGGCAGG No data
1190527878_1190527882 15 Left 1190527878 X:51346241-51346263 CCGGTAGCAGGCCAAGAGCTATT No data
Right 1190527882 X:51346279-51346301 AGTTATATGCAGAGCATGGCAGG No data
1190527877_1190527882 16 Left 1190527877 X:51346240-51346262 CCCGGTAGCAGGCCAAGAGCTAT No data
Right 1190527882 X:51346279-51346301 AGTTATATGCAGAGCATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190527882 Original CRISPR AGTTATATGCAGAGCATGGC AGG Intergenic
No off target data available for this crispr