ID: 1190536810 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:51437067-51437089 |
| Sequence | TGAGGTTACAAGATCATGCA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1190536810_1190536813 | -2 | Left | 1190536810 | X:51437067-51437089 | CCATGCATGATCTTGTAACCTCA | No data | ||
| Right | 1190536813 | X:51437088-51437110 | CATGATTGATTATTTGGAAAAGG | No data | ||||
| 1190536810_1190536811 | -8 | Left | 1190536810 | X:51437067-51437089 | CCATGCATGATCTTGTAACCTCA | No data | ||
| Right | 1190536811 | X:51437082-51437104 | TAACCTCATGATTGATTATTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1190536810 | Original CRISPR | TGAGGTTACAAGATCATGCA TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||