ID: 1190536810

View in Genome Browser
Species Human (GRCh38)
Location X:51437067-51437089
Sequence TGAGGTTACAAGATCATGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190536810_1190536813 -2 Left 1190536810 X:51437067-51437089 CCATGCATGATCTTGTAACCTCA No data
Right 1190536813 X:51437088-51437110 CATGATTGATTATTTGGAAAAGG No data
1190536810_1190536811 -8 Left 1190536810 X:51437067-51437089 CCATGCATGATCTTGTAACCTCA No data
Right 1190536811 X:51437082-51437104 TAACCTCATGATTGATTATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190536810 Original CRISPR TGAGGTTACAAGATCATGCA TGG (reversed) Intergenic
No off target data available for this crispr