ID: 1190543963

View in Genome Browser
Species Human (GRCh38)
Location X:51505700-51505722
Sequence AATCATTTTATCCCTTCACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190543963_1190543969 23 Left 1190543963 X:51505700-51505722 CCTTGTGAAGGGATAAAATGATT No data
Right 1190543969 X:51505746-51505768 CCTGTTGAAGCTGGATCTGGAGG 0: 1
1: 0
2: 1
3: 17
4: 220
1190543963_1190543966 14 Left 1190543963 X:51505700-51505722 CCTTGTGAAGGGATAAAATGATT No data
Right 1190543966 X:51505737-51505759 CTTCAAGGTCCTGTTGAAGCTGG 0: 1
1: 0
2: 1
3: 12
4: 127
1190543963_1190543970 26 Left 1190543963 X:51505700-51505722 CCTTGTGAAGGGATAAAATGATT No data
Right 1190543970 X:51505749-51505771 GTTGAAGCTGGATCTGGAGGAGG 0: 1
1: 0
2: 3
3: 22
4: 329
1190543963_1190543965 -1 Left 1190543963 X:51505700-51505722 CCTTGTGAAGGGATAAAATGATT No data
Right 1190543965 X:51505722-51505744 TGGTACTTACAGCTGCTTCAAGG No data
1190543963_1190543967 20 Left 1190543963 X:51505700-51505722 CCTTGTGAAGGGATAAAATGATT No data
Right 1190543967 X:51505743-51505765 GGTCCTGTTGAAGCTGGATCTGG 0: 1
1: 0
2: 0
3: 8
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190543963 Original CRISPR AATCATTTTATCCCTTCACA AGG (reversed) Intergenic