ID: 1190543965

View in Genome Browser
Species Human (GRCh38)
Location X:51505722-51505744
Sequence TGGTACTTACAGCTGCTTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190543963_1190543965 -1 Left 1190543963 X:51505700-51505722 CCTTGTGAAGGGATAAAATGATT No data
Right 1190543965 X:51505722-51505744 TGGTACTTACAGCTGCTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190543965 Original CRISPR TGGTACTTACAGCTGCTTCA AGG Intergenic
No off target data available for this crispr