ID: 1190554760

View in Genome Browser
Species Human (GRCh38)
Location X:51623054-51623076
Sequence ATTTGCAGGTAATTGAAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190554760_1190554771 29 Left 1190554760 X:51623054-51623076 CCCTCTTTCAATTACCTGCAAAT No data
Right 1190554771 X:51623106-51623128 TGAGGTATTTAAAACTTTCTAGG No data
1190554760_1190554770 11 Left 1190554760 X:51623054-51623076 CCCTCTTTCAATTACCTGCAAAT No data
Right 1190554770 X:51623088-51623110 TCAATGCAAATTGAGGGGTGAGG No data
1190554760_1190554767 4 Left 1190554760 X:51623054-51623076 CCCTCTTTCAATTACCTGCAAAT No data
Right 1190554767 X:51623081-51623103 GGGCAGGTCAATGCAAATTGAGG No data
1190554760_1190554768 5 Left 1190554760 X:51623054-51623076 CCCTCTTTCAATTACCTGCAAAT No data
Right 1190554768 X:51623082-51623104 GGCAGGTCAATGCAAATTGAGGG No data
1190554760_1190554772 30 Left 1190554760 X:51623054-51623076 CCCTCTTTCAATTACCTGCAAAT No data
Right 1190554772 X:51623107-51623129 GAGGTATTTAAAACTTTCTAGGG No data
1190554760_1190554769 6 Left 1190554760 X:51623054-51623076 CCCTCTTTCAATTACCTGCAAAT No data
Right 1190554769 X:51623083-51623105 GCAGGTCAATGCAAATTGAGGGG 0: 3
1: 4
2: 17
3: 41
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190554760 Original CRISPR ATTTGCAGGTAATTGAAAGA GGG (reversed) Intergenic
No off target data available for this crispr