ID: 1190554766

View in Genome Browser
Species Human (GRCh38)
Location X:51623068-51623090
Sequence TGACCTGCCCCTTAATTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190554766_1190554771 15 Left 1190554766 X:51623068-51623090 CCTGCAAATTAAGGGGCAGGTCA No data
Right 1190554771 X:51623106-51623128 TGAGGTATTTAAAACTTTCTAGG No data
1190554766_1190554772 16 Left 1190554766 X:51623068-51623090 CCTGCAAATTAAGGGGCAGGTCA No data
Right 1190554772 X:51623107-51623129 GAGGTATTTAAAACTTTCTAGGG No data
1190554766_1190554770 -3 Left 1190554766 X:51623068-51623090 CCTGCAAATTAAGGGGCAGGTCA No data
Right 1190554770 X:51623088-51623110 TCAATGCAAATTGAGGGGTGAGG No data
1190554766_1190554767 -10 Left 1190554766 X:51623068-51623090 CCTGCAAATTAAGGGGCAGGTCA No data
Right 1190554767 X:51623081-51623103 GGGCAGGTCAATGCAAATTGAGG No data
1190554766_1190554776 26 Left 1190554766 X:51623068-51623090 CCTGCAAATTAAGGGGCAGGTCA No data
Right 1190554776 X:51623117-51623139 AAACTTTCTAGGGGGAGAGGCGG No data
1190554766_1190554774 18 Left 1190554766 X:51623068-51623090 CCTGCAAATTAAGGGGCAGGTCA No data
Right 1190554774 X:51623109-51623131 GGTATTTAAAACTTTCTAGGGGG No data
1190554766_1190554769 -8 Left 1190554766 X:51623068-51623090 CCTGCAAATTAAGGGGCAGGTCA No data
Right 1190554769 X:51623083-51623105 GCAGGTCAATGCAAATTGAGGGG 0: 3
1: 4
2: 17
3: 41
4: 139
1190554766_1190554775 23 Left 1190554766 X:51623068-51623090 CCTGCAAATTAAGGGGCAGGTCA No data
Right 1190554775 X:51623114-51623136 TTAAAACTTTCTAGGGGGAGAGG No data
1190554766_1190554768 -9 Left 1190554766 X:51623068-51623090 CCTGCAAATTAAGGGGCAGGTCA No data
Right 1190554768 X:51623082-51623104 GGCAGGTCAATGCAAATTGAGGG No data
1190554766_1190554773 17 Left 1190554766 X:51623068-51623090 CCTGCAAATTAAGGGGCAGGTCA No data
Right 1190554773 X:51623108-51623130 AGGTATTTAAAACTTTCTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190554766 Original CRISPR TGACCTGCCCCTTAATTTGC AGG (reversed) Intergenic
No off target data available for this crispr