ID: 1190554767

View in Genome Browser
Species Human (GRCh38)
Location X:51623081-51623103
Sequence GGGCAGGTCAATGCAAATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190554760_1190554767 4 Left 1190554760 X:51623054-51623076 CCCTCTTTCAATTACCTGCAAAT No data
Right 1190554767 X:51623081-51623103 GGGCAGGTCAATGCAAATTGAGG No data
1190554766_1190554767 -10 Left 1190554766 X:51623068-51623090 CCTGCAAATTAAGGGGCAGGTCA No data
Right 1190554767 X:51623081-51623103 GGGCAGGTCAATGCAAATTGAGG No data
1190554761_1190554767 3 Left 1190554761 X:51623055-51623077 CCTCTTTCAATTACCTGCAAATT No data
Right 1190554767 X:51623081-51623103 GGGCAGGTCAATGCAAATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190554767 Original CRISPR GGGCAGGTCAATGCAAATTG AGG Intergenic
No off target data available for this crispr