ID: 1190556057

View in Genome Browser
Species Human (GRCh38)
Location X:51637016-51637038
Sequence CCAGTAGGGTACCCAAAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190556057_1190556063 -8 Left 1190556057 X:51637016-51637038 CCAGACTTTGGGTACCCTACTGG No data
Right 1190556063 X:51637031-51637053 CCTACTGGTGGTGTTGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190556057 Original CRISPR CCAGTAGGGTACCCAAAGTC TGG (reversed) Intergenic
No off target data available for this crispr