ID: 1190556063

View in Genome Browser
Species Human (GRCh38)
Location X:51637031-51637053
Sequence CCTACTGGTGGTGTTGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190556053_1190556063 4 Left 1190556053 X:51637004-51637026 CCTTTGTCGCCACCAGACTTTGG No data
Right 1190556063 X:51637031-51637053 CCTACTGGTGGTGTTGAGGCTGG No data
1190556057_1190556063 -8 Left 1190556057 X:51637016-51637038 CCAGACTTTGGGTACCCTACTGG No data
Right 1190556063 X:51637031-51637053 CCTACTGGTGGTGTTGAGGCTGG No data
1190556056_1190556063 -5 Left 1190556056 X:51637013-51637035 CCACCAGACTTTGGGTACCCTAC No data
Right 1190556063 X:51637031-51637053 CCTACTGGTGGTGTTGAGGCTGG No data
1190556052_1190556063 20 Left 1190556052 X:51636988-51637010 CCTGTCTCTTATCATTCCTTTGT No data
Right 1190556063 X:51637031-51637053 CCTACTGGTGGTGTTGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190556063 Original CRISPR CCTACTGGTGGTGTTGAGGC TGG Intergenic
No off target data available for this crispr