ID: 1190559624

View in Genome Browser
Species Human (GRCh38)
Location X:51673981-51674003
Sequence CCTTATGGACAGCTCGGGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190559617_1190559624 11 Left 1190559617 X:51673947-51673969 CCATTGGGATTCATTAGTTAGGA No data
Right 1190559624 X:51673981-51674003 CCTTATGGACAGCTCGGGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190559624 Original CRISPR CCTTATGGACAGCTCGGGGT TGG Intergenic
No off target data available for this crispr