ID: 1190564667

View in Genome Browser
Species Human (GRCh38)
Location X:51719340-51719362
Sequence CCTTATGGACAGCTCGGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190564667_1190564674 11 Left 1190564667 X:51719340-51719362 CCAACCCCGAGCTGTCCATAAGG No data
Right 1190564674 X:51719374-51719396 TCCTAACTAATGAATCCCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190564667 Original CRISPR CCTTATGGACAGCTCGGGGT TGG (reversed) Intergenic
No off target data available for this crispr