ID: 1190566846

View in Genome Browser
Species Human (GRCh38)
Location X:51739147-51739169
Sequence CAGTGATGCTAGATGTAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190566841_1190566846 24 Left 1190566841 X:51739100-51739122 CCTAAACCTGGATGAAACTTAAG No data
Right 1190566846 X:51739147-51739169 CAGTGATGCTAGATGTAAGATGG No data
1190566842_1190566846 18 Left 1190566842 X:51739106-51739128 CCTGGATGAAACTTAAGACTCTG No data
Right 1190566846 X:51739147-51739169 CAGTGATGCTAGATGTAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190566846 Original CRISPR CAGTGATGCTAGATGTAAGA TGG Intergenic
No off target data available for this crispr