ID: 1190567683

View in Genome Browser
Species Human (GRCh38)
Location X:51747405-51747427
Sequence ACACAAAGGGACAATGTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190567683_1190567686 -6 Left 1190567683 X:51747405-51747427 CCTTCTACATTGTCCCTTTGTGT No data
Right 1190567686 X:51747422-51747444 TTGTGTGTACATGTACCTCCAGG No data
1190567683_1190567691 25 Left 1190567683 X:51747405-51747427 CCTTCTACATTGTCCCTTTGTGT No data
Right 1190567691 X:51747453-51747475 CCTGTCAGAGATAGCCACACTGG No data
1190567683_1190567687 -5 Left 1190567683 X:51747405-51747427 CCTTCTACATTGTCCCTTTGTGT No data
Right 1190567687 X:51747423-51747445 TGTGTGTACATGTACCTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190567683 Original CRISPR ACACAAAGGGACAATGTAGA AGG (reversed) Intergenic
No off target data available for this crispr