ID: 1190567732

View in Genome Browser
Species Human (GRCh38)
Location X:51747876-51747898
Sequence GATGATTTCCCATCAAAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190567728_1190567732 10 Left 1190567728 X:51747843-51747865 CCAGGACAGAACTCTTTGTCTCC No data
Right 1190567732 X:51747876-51747898 GATGATTTCCCATCAAAAACTGG No data
1190567727_1190567732 17 Left 1190567727 X:51747836-51747858 CCACAAGCCAGGACAGAACTCTT No data
Right 1190567732 X:51747876-51747898 GATGATTTCCCATCAAAAACTGG No data
1190567726_1190567732 23 Left 1190567726 X:51747830-51747852 CCAAAACCACAAGCCAGGACAGA No data
Right 1190567732 X:51747876-51747898 GATGATTTCCCATCAAAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190567732 Original CRISPR GATGATTTCCCATCAAAAAC TGG Intergenic
No off target data available for this crispr