ID: 1190571453

View in Genome Browser
Species Human (GRCh38)
Location X:51786677-51786699
Sequence GGTACCAAGGGAGGCTAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190571453_1190571468 16 Left 1190571453 X:51786677-51786699 CCCACTTAGCCTCCCTTGGTACC No data
Right 1190571468 X:51786716-51786738 CCTCATTACTACTGGGAAAAGGG No data
1190571453_1190571465 9 Left 1190571453 X:51786677-51786699 CCCACTTAGCCTCCCTTGGTACC No data
Right 1190571465 X:51786709-51786731 AGGGGTTCCTCATTACTACTGGG No data
1190571453_1190571460 -10 Left 1190571453 X:51786677-51786699 CCCACTTAGCCTCCCTTGGTACC No data
Right 1190571460 X:51786690-51786712 CCTTGGTACCCAGAGAAGGAGGG No data
1190571453_1190571461 -9 Left 1190571453 X:51786677-51786699 CCCACTTAGCCTCCCTTGGTACC No data
Right 1190571461 X:51786691-51786713 CTTGGTACCCAGAGAAGGAGGGG No data
1190571453_1190571469 20 Left 1190571453 X:51786677-51786699 CCCACTTAGCCTCCCTTGGTACC No data
Right 1190571469 X:51786720-51786742 ATTACTACTGGGAAAAGGGTAGG No data
1190571453_1190571466 15 Left 1190571453 X:51786677-51786699 CCCACTTAGCCTCCCTTGGTACC No data
Right 1190571466 X:51786715-51786737 TCCTCATTACTACTGGGAAAAGG No data
1190571453_1190571464 8 Left 1190571453 X:51786677-51786699 CCCACTTAGCCTCCCTTGGTACC No data
Right 1190571464 X:51786708-51786730 GAGGGGTTCCTCATTACTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190571453 Original CRISPR GGTACCAAGGGAGGCTAAGT GGG (reversed) Intergenic
No off target data available for this crispr