ID: 1190576675

View in Genome Browser
Species Human (GRCh38)
Location X:51846364-51846386
Sequence CCTACTTTGAAGATGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 898
Summary {0: 1, 1: 1, 2: 9, 3: 133, 4: 754}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190576675 Original CRISPR CCTACTTTGAAGATGGAAGA TGG Intronic
900937931 1:5778770-5778792 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
900961234 1:5922133-5922155 CTGCCTTTGAAGATGGAAGAAGG + Intronic
901194227 1:7431541-7431563 CCCACTTGGCAGATCGAAGAAGG + Intronic
901433787 1:9234384-9234406 CCTACTCTGGATATTGAAGACGG + Intergenic
901471529 1:9460018-9460040 GCTGCTTTGAGGATGGAGGAAGG - Intergenic
901517707 1:9760463-9760485 TCTACTTTTAATAAGGAAGACGG + Intronic
902256340 1:15191169-15191191 TATGCTTTGAAGGTGGAAGAAGG + Intronic
902275787 1:15338355-15338377 CTGGCTTTGAAGATGGAGGAAGG - Intronic
902998877 1:20250063-20250085 GTGGCTTTGAAGATGGAAGAAGG + Intergenic
903090795 1:20914412-20914434 CTGGCTTTGAAGATGGAGGAAGG + Intronic
903565535 1:24262549-24262571 TGTTCTTTGAAGATGGAGGAAGG - Intergenic
903688746 1:25153931-25153953 CTGGCTTTGAAGATGGAAGAGGG - Intergenic
903757450 1:25672510-25672532 CTGGCTTTGAAGATGGAGGAAGG - Intronic
904096024 1:27978069-27978091 CTGTCTTTGAAGATGGAAGATGG + Intronic
904786406 1:32986394-32986416 AAGAATTTGAAGATGGAAGAGGG + Intergenic
905235786 1:36546968-36546990 TCAGCTTTGAAGATGGAGGACGG + Intergenic
905413662 1:37790083-37790105 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
905737965 1:40343767-40343789 CTAACTTTGAAGATGGAGGAAGG - Intergenic
905992435 1:42350295-42350317 CTGGCTTTGAAGATGGAAGTGGG - Intergenic
906483552 1:46217499-46217521 CCTATTAGGAGGATGGAAGATGG + Intronic
906770807 1:48480575-48480597 CTAACTTTGAAGCTAGAAGAAGG - Intergenic
906874245 1:49519103-49519125 ACTACTTTGAAGTTGGAGAAAGG + Intronic
907393557 1:54174400-54174422 CCTACTATGTAGAAGGAGGATGG - Exonic
907548661 1:55285531-55285553 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
907933094 1:59018349-59018371 CTGACTTTGAAGATGAAGGAAGG + Intergenic
908096783 1:60747630-60747652 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
908769615 1:67584059-67584081 CAATCATTGAAGATGGAAGATGG + Intergenic
908888146 1:68813693-68813715 CTGACTTTGAAGAAGGAGGAAGG + Intergenic
910047572 1:82936388-82936410 CTAGCTTTGAAGATGGAGGAAGG - Intergenic
910142433 1:84040501-84040523 CCTACTTTCATTATGGAAGATGG + Intergenic
910144774 1:84067025-84067047 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
910207800 1:84765205-84765227 TTGACTTTGAAGATGGAGGAAGG - Intergenic
910550744 1:88471352-88471374 CCCATTTTAAAGATGGAGGAAGG - Intergenic
910802433 1:91159574-91159596 CCAGCTTTGAAGATGGAGGAAGG + Intergenic
911365655 1:96934529-96934551 CAGGCTTTGAAGATGGAAGGGGG - Intergenic
911740310 1:101379789-101379811 TTTGCTTTGAAGATGGAGGAAGG - Intergenic
912015760 1:105033500-105033522 CTAGCTTTGAAGATGGAGGAAGG - Intergenic
912913388 1:113786544-113786566 TATACTTTGAAGATGGAGGAAGG + Intronic
913157228 1:116111765-116111787 CCAGCTTTCAAGTTGGAAGAGGG + Exonic
913372298 1:118114340-118114362 CCTATATTGAAAATGGAAGGTGG + Intronic
914260242 1:145993001-145993023 CTTACATTTAAGATGGCAGAAGG + Exonic
916704882 1:167339108-167339130 CTGGCTTTGAAGATGGAGGAAGG - Intronic
916744300 1:167672539-167672561 CTGTCTTTGAAGATGGAGGAAGG - Intronic
916807949 1:168278560-168278582 CTGGCTTTGAAGATGGAAAAAGG - Intergenic
917644918 1:177020434-177020456 CAGACTTTGAATATGGAGGAAGG - Intronic
917847137 1:179029183-179029205 CTTATTTTGACGGTGGAAGAGGG + Intronic
918333796 1:183487267-183487289 CTGGCTTTGAAGATGGAAGGGGG - Intronic
918370556 1:183857202-183857224 CTGGCTTTGAAGATGGAGGAAGG + Intronic
918405116 1:184204478-184204500 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
918549480 1:185725005-185725027 TCTATTTTGAAGATATAAGAAGG + Intergenic
918892312 1:190291473-190291495 CCTGATTTGAAAATGAAAGAAGG + Intronic
919019036 1:192079857-192079879 CTGCCTTTGAAGGTGGAAGAAGG - Intergenic
919182357 1:194103182-194103204 CCTACACTGGAGATGGATGATGG - Intergenic
919463370 1:197904172-197904194 TCTGCTTTGAGGCTGGAAGAAGG - Intronic
919500863 1:198336768-198336790 CTGGCTTTGAAGATGGAAGAAGG - Intergenic
919600501 1:199616504-199616526 CCAACTTGGAAGATGGATGTTGG - Intergenic
919659997 1:200234956-200234978 CATACTTAGTAGATGGCAGAGGG - Intergenic
919719080 1:200812417-200812439 CCTAATTTGAAAATGGAATGAGG - Intronic
919834569 1:201564864-201564886 CTGACTTTGAAGATGGAAAAAGG - Intergenic
920074418 1:203326037-203326059 CCAACTTTGAAGATGGGGAATGG - Intergenic
920207086 1:204300042-204300064 AGTACTTAGAAGATAGAAGAGGG + Intronic
920789482 1:209075692-209075714 GCTACTTGGAAGACTGAAGAAGG + Intergenic
920852792 1:209640005-209640027 CCAGCTTTGGAGAGGGAAGATGG - Intronic
921012211 1:211153189-211153211 GCTACTTGGAAGATGGAGGTGGG - Intergenic
921129226 1:212205349-212205371 CATCCTTTCTAGATGGAAGATGG - Intergenic
921749230 1:218773803-218773825 CTGGCTTTAAAGATGGAAGAAGG - Intergenic
922591677 1:226782076-226782098 TGTACTTTGAAGATGGAGGAAGG - Intergenic
923057439 1:230437566-230437588 TGCACTTTGAAGATGGAGGAAGG - Intergenic
923230078 1:231977435-231977457 GGCACTTTGAAGATGGAGGAAGG - Intronic
923286242 1:232498647-232498669 CTTGCTGTGAAGATGGAGGAAGG - Intronic
923599616 1:235390842-235390864 TTTATTCTGAAGATGGAAGAGGG + Intronic
1063768436 10:9169492-9169514 CCTTCATTGAAGAGGGAAGGAGG + Intergenic
1063811849 10:9720240-9720262 ATTATTGTGAAGATGGAAGAAGG + Intergenic
1064336033 10:14442244-14442266 CATGCTTTGAGGATGGAGGAAGG + Intronic
1065400925 10:25300287-25300309 CTGCCTTTGAAGCTGGAAGAAGG - Intronic
1065414946 10:25474099-25474121 CCAACTTTGAAGATAAATGAGGG + Intronic
1066286114 10:33967853-33967875 ACTATTTTGAAGATGAAAAATGG + Intergenic
1067921599 10:50464315-50464337 CTGACTTTAAAGATGGAAAAGGG + Intronic
1068065992 10:52131733-52131755 GCTACTTTGAACCTGGGAGACGG + Intronic
1068105955 10:52616622-52616644 CTGGCTTTGAAGATGGAAGAGGG - Intergenic
1068149617 10:53115407-53115429 CTGGCTTTAAAGATGGAAGAAGG + Intergenic
1068331028 10:55569037-55569059 CCTCCTTTGAAGAGGCAATAAGG + Intronic
1068525785 10:58127805-58127827 CTGGCTTTGAAGGTGGAAGAAGG - Intergenic
1068786995 10:60987564-60987586 CCTACATGGGAGATGGAGGATGG - Intronic
1068988698 10:63130067-63130089 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
1069086573 10:64146843-64146865 CTGACTTTGCAGATGGAGGAAGG + Intergenic
1069310091 10:67024196-67024218 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1070015729 10:72528353-72528375 CCTACTTTAAAAATGGGATAGGG + Intronic
1070261171 10:74857366-74857388 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1070629453 10:78074568-78074590 CTGGCTTTGAAGATGGAAGAGGG + Intergenic
1071008493 10:80910946-80910968 TGTACGTTGAAGATGGAGGAAGG + Intergenic
1071318046 10:84422132-84422154 CTCACTTTGCAGAAGGAAGAAGG + Intronic
1071351805 10:84754062-84754084 CCGACCTTGAAGAAGGAAGCAGG - Intergenic
1071668764 10:87587395-87587417 CCGGCTTTGAAGATGGCAGAGGG + Intergenic
1071805616 10:89117279-89117301 CTGACTTTGAAGATGGAAGAAGG + Intergenic
1071976051 10:90956477-90956499 CTGGCTTTGAGGATGGAAGAAGG + Intergenic
1071979300 10:90987565-90987587 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1072169594 10:92846976-92846998 CTAGCTTTGAAGATGGAGGAAGG + Intronic
1072340702 10:94445639-94445661 CATATTTTGAAGATGGAAAAAGG - Intronic
1072355789 10:94609133-94609155 CCTACTCGGAAGATGGAGGCAGG - Intronic
1072910511 10:99496847-99496869 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1073025361 10:100483397-100483419 CAGAGGTTGAAGATGGAAGAGGG + Exonic
1073298503 10:102456100-102456122 CCGGCTTTGAATACGGAAGACGG + Intergenic
1073604964 10:104884975-104884997 GCTTCTTTGAAGATGGTAGGAGG + Intronic
1074153175 10:110776530-110776552 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1074202995 10:111256435-111256457 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1074414277 10:113253550-113253572 CTGGCTTTGAAGATGGAAGGTGG - Intergenic
1074535192 10:114324084-114324106 CCTACTATGCAGGTGGAATAAGG - Intronic
1075192401 10:120321825-120321847 CTGACTATGAGGATGGAAGAAGG + Intergenic
1075255003 10:120918782-120918804 CTCACTTTAAATATGGAAGACGG - Intergenic
1075272513 10:121064658-121064680 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1075303062 10:121342499-121342521 CATAATTTTGAGATGGAAGAGGG + Intergenic
1075393540 10:122110993-122111015 CTGACTTTGAAGATGAAGGAAGG - Intronic
1076071328 10:127492338-127492360 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1076292445 10:129357147-129357169 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1076930077 10:133526461-133526483 CCTTCATAGAAGGTGGAAGAGGG + Intronic
1077728274 11:4699500-4699522 CTGGCTTTGAAGATGGCAGAAGG + Intergenic
1077746295 11:4910209-4910231 CTGGCTTTGAAGATGAAAGAGGG - Intronic
1077781447 11:5334295-5334317 CCTCCTTTGGAGAAGGAAGTGGG + Intronic
1077921915 11:6647645-6647667 CCTTGTTTGAAAATGGAAGCCGG - Intronic
1077928103 11:6702546-6702568 CTGGCTTTGAAGATGGAAGGGGG + Intergenic
1078267901 11:9768664-9768686 CTGGCTTTGAAGATGGAAGGGGG - Intergenic
1078919278 11:15813265-15813287 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1079166630 11:18050110-18050132 CTTGCTTTGAAGATGGACAAAGG - Intergenic
1079326893 11:19501078-19501100 CTGACTTTGAAGATGGAAGGAGG - Intronic
1079370974 11:19851974-19851996 CAGGCTTTGAAGGTGGAAGAAGG + Intronic
1079641722 11:22813976-22813998 CTGATTTTGAAGATGGAGGAAGG - Intronic
1079685548 11:23354862-23354884 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1079908173 11:26275581-26275603 CCTCCTTTGAGGATGGAGGCAGG + Intergenic
1080228397 11:29987009-29987031 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
1080247890 11:30199977-30199999 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1080615158 11:33939345-33939367 CTGACTTTGAAGCTGGAGGAAGG + Intergenic
1080709737 11:34735149-34735171 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1080963723 11:37190002-37190024 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
1081158917 11:39729401-39729423 TCTTGTTTGAAGATGGACGAAGG - Intergenic
1081296667 11:41398546-41398568 CCCCTTTTGAAGAAGGAAGAGGG + Intronic
1081350534 11:42046314-42046336 CCGCCTTTGAAGATGGACAAAGG + Intergenic
1081601164 11:44495385-44495407 TCCACTTTGAAGATGAAGGAAGG - Intergenic
1081602569 11:44505464-44505486 CCACCTTTGGAGATGGAGGAAGG + Intergenic
1082140862 11:48607476-48607498 TCTATTTTGATGATGGAAGAGGG + Intergenic
1082569636 11:54722350-54722372 CTAGTTTTGAAGATGGAAGAGGG + Intergenic
1083119439 11:60496857-60496879 CCAACTGTGAAGTTGGAGGAAGG - Intronic
1083151948 11:60797525-60797547 CTGGCTTTGAAGGTGGAAGAAGG - Intronic
1083580414 11:63821235-63821257 CTGGCTTTGAAGATGGAAGGAGG - Intronic
1084230875 11:67751746-67751768 CCTTCTTTGAAGCAGAAAGATGG - Intergenic
1084563486 11:69916999-69917021 CTGACTTTGAAGATGGAGGAAGG - Intergenic
1084744371 11:71159276-71159298 CCCACTTTGAAATTGGAGGAAGG - Intronic
1085058502 11:73423188-73423210 ACAACTTTGGAGATGGAAGAGGG - Intronic
1085336892 11:75703230-75703252 TGTACTTTGAACATGGAAGAAGG - Intergenic
1085999637 11:81966442-81966464 CTGAACTTGAAGATGGAAGAAGG + Intergenic
1086055996 11:82647105-82647127 CTGGCTTTGAAGATGGAGGAGGG + Intergenic
1086061786 11:82707561-82707583 CCTACTTGCAGGAGGGAAGAGGG - Intergenic
1087518748 11:99201740-99201762 CTGACTCTGAAGATGGAAGGGGG + Intronic
1087811003 11:102609151-102609173 TATACTATAAAGATGGAAGATGG - Intronic
1088572520 11:111236818-111236840 CTGCCTTTGAAGATTGAAGAAGG - Intergenic
1089147959 11:116344131-116344153 CTTACTCTGAAGATGGAGGAAGG - Intergenic
1089820357 11:121220234-121220256 CTGACTTTGAAGATGGAGGAAGG + Intergenic
1089900117 11:121973232-121973254 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
1089949566 11:122512672-122512694 GTGACTTTGAAGATGGAGGAAGG - Intergenic
1090328074 11:125905851-125905873 GCTACTTTGAAGTTAGAGGATGG + Intronic
1090342337 11:126035409-126035431 CCAAGTTTAAAGATGGAATAAGG - Intronic
1091538769 12:1439810-1439832 CCTAATCTCAAGAGGGAAGAGGG - Intronic
1092025059 12:5233091-5233113 CCTCCTTGCAAGAGGGAAGAGGG - Intergenic
1092654559 12:10671488-10671510 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1092671980 12:10873587-10873609 CTAGCTTTAAAGATGGAAGAGGG - Intronic
1092673363 12:10888088-10888110 CTGGCATTGAAGATGGAAGAAGG - Intronic
1092702414 12:11246944-11246966 CTGGCATTGAAGATGGAAGAGGG + Intergenic
1092711993 12:11348699-11348721 CTGGCATTGAAGATGGAAGAGGG + Intergenic
1092870184 12:12799436-12799458 CAGGCTTTGAAGATGGAGGAAGG - Intronic
1092995010 12:13941408-13941430 CCTGCTGTGAAGATGGACAAAGG + Intronic
1093105885 12:15086583-15086605 CTGACTTTGAAGAAGGAGGAAGG - Intergenic
1093323226 12:17739891-17739913 CTGGCTTTGAAGATGGAAGGAGG - Intergenic
1093338840 12:17946182-17946204 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1093786619 12:23199217-23199239 ATGACTTTGAAGAGGGAAGAAGG + Intergenic
1094318521 12:29159171-29159193 GCTAGTTAGAAGAGGGAAGAAGG - Intronic
1094334899 12:29338530-29338552 CCTACTCAGCAGATGGAAGCAGG + Exonic
1095203262 12:39410135-39410157 CTGACTTTCAAGATGCAAGAAGG + Intronic
1095326265 12:40897007-40897029 CTGACTTAGAAGTTGGAAGATGG + Intronic
1095494728 12:42772449-42772471 ACTGGCTTGAAGATGGAAGATGG - Intergenic
1095615627 12:44184536-44184558 CGTGCCTTGAAGATGGTAGAAGG + Intronic
1096784103 12:54007331-54007353 CCAGCTCTGGAGATGGAAGAAGG - Intronic
1096812581 12:54181051-54181073 CCAACAATGAAGAGGGAAGAGGG + Intronic
1096884335 12:54701407-54701429 CCAGCTTTGAAGAAGGAAGCGGG + Intergenic
1097122904 12:56749610-56749632 CTTACTTTGATGATGAGAGACGG + Intronic
1097290573 12:57911042-57911064 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1097411465 12:59258757-59258779 CTGACTCTGAAGATGGAAGCAGG + Intergenic
1097429851 12:59491436-59491458 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1097583944 12:61492729-61492751 CTGGCTTTGAAGATGGAACAAGG + Intergenic
1097941262 12:65308769-65308791 CCTAATTTGAAGACGGAAATTGG + Intronic
1098576764 12:72051537-72051559 CTTGCTTTGAAGATGGAAAAAGG - Intronic
1098638610 12:72814065-72814087 CTGACTTTGAAAATGGAGGAAGG - Intergenic
1098685376 12:73412905-73412927 CTTGCTTTGGAGATGGAGGAAGG + Intergenic
1098826464 12:75303891-75303913 AAGACTTTGAAGATGGAGGAAGG + Intronic
1099015268 12:77336714-77336736 CTGACTTTGAAAATGGAAGAAGG + Intergenic
1099030474 12:77520145-77520167 CTGGCTTTGAAGATGGAAGAAGG - Intergenic
1099811424 12:87587322-87587344 CTAGCTTTGAAGATGGAGGAGGG - Intergenic
1099863565 12:88249645-88249667 CGTGCTTTTAAGATGGAGGAAGG + Intergenic
1099880043 12:88456761-88456783 CTGACTTTGAAGCTGAAAGAAGG - Intergenic
1100714657 12:97293326-97293348 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1100787334 12:98092289-98092311 CTTGCTTTGACGATGGAGGAAGG + Intergenic
1102185821 12:110947868-110947890 CTGCCTTTGAAGATGGAGGAAGG - Intergenic
1102560138 12:113756076-113756098 CTGACCTTGAAGAAGGAAGAAGG + Intergenic
1102620941 12:114193934-114193956 AGCACTTTGAAGATGGAGGAAGG + Intergenic
1103015693 12:117492841-117492863 CTGACTTTGAAGATGGAGAAGGG + Intronic
1103041686 12:117701045-117701067 CCTATTGTGCAGATGGAGGATGG - Intronic
1103799423 12:123527808-123527830 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1104166837 12:126239889-126239911 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1104369869 12:128215113-128215135 TGTGCTTTGAAGATGGAGGAAGG + Intergenic
1104369994 12:128215971-128215993 TGTGCTTTGAAGATGGAGGAAGG + Intergenic
1105283129 13:18981330-18981352 CTTACTTGGAAGCTGGAAGGTGG - Intergenic
1105686486 13:22787780-22787802 CCTACTTTGAAAATAGATTATGG - Intergenic
1105881629 13:24611208-24611230 GTGACTGTGAAGATGGAAGAAGG - Intergenic
1106454725 13:29917133-29917155 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1106670652 13:31901056-31901078 CTGGCTTTGAAGATGGATGAAGG - Intergenic
1106743358 13:32672226-32672248 CCTTCTATGAAAATGTAAGAAGG + Intronic
1106873280 13:34044619-34044641 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
1107279642 13:38719187-38719209 CTGGCTTTGAAGCTGGAAGAAGG - Intronic
1107539145 13:41369732-41369754 CTGGCTTTGAAGATGGAAGGAGG + Intronic
1107630352 13:42336347-42336369 CCGGCTTTGAAGAGGGAGGAAGG + Intergenic
1107676654 13:42804665-42804687 CCTTCTTAGAGGATGTAAGAAGG + Intergenic
1107884932 13:44867350-44867372 CTGGCTTTGAAGATGGAGGATGG - Intergenic
1108149428 13:47517176-47517198 CTGACTTTGAACATGGAGGAAGG - Intergenic
1108581206 13:51829891-51829913 CCCACTTTTAAGAAGGAAAAGGG - Intergenic
1108697473 13:52915195-52915217 TGTGCTTTCAAGATGGAAGAAGG + Intergenic
1108698906 13:52927015-52927037 CTGGCTTTGAAGATGGAGGATGG + Intergenic
1109121519 13:58463592-58463614 CCTATTTTGAAGATAGACCATGG - Intergenic
1109696298 13:65963334-65963356 CTGACTTTGAAGATGGGAGGGGG + Intergenic
1109983849 13:69948776-69948798 CAGACTTTGTAGATGAAAGATGG - Intronic
1110408386 13:75176278-75176300 CTGGCTTTGAAGATGGAGGATGG + Intergenic
1110427726 13:75388071-75388093 CCGGCTTTGCAGGTGGAAGAAGG - Intronic
1110574449 13:77039772-77039794 TCGGCTTTGAAGATGGAGGAAGG - Intergenic
1110593633 13:77293745-77293767 CTGGCTTTGAAGATGGAAGGGGG + Intronic
1111834772 13:93374655-93374677 CCTATTTTGAAAATAGTAGAAGG - Intronic
1112191356 13:97181024-97181046 CTGGCTTTCAAGATGGAAGAAGG - Intergenic
1112407188 13:99131485-99131507 AGTGCTTTGAAGATGGAGGAAGG + Intergenic
1112809102 13:103197024-103197046 CCTGCTTTGCAGGTGGGAGATGG + Intergenic
1113283333 13:108815477-108815499 GCTGCTTTGAAGATGGTGGAAGG + Intronic
1113408744 13:110065290-110065312 GCTGCTTTGAAGATGGAGGGAGG - Intergenic
1113976291 13:114230212-114230234 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1114389072 14:22286407-22286429 CTAGTTTTGAAGATGGAAGAGGG - Intergenic
1114498216 14:23148694-23148716 CTGGCTTTGAAGATGAAAGATGG + Intronic
1114976886 14:28112890-28112912 CCTACTTTGATGATGCAGAAAGG - Intergenic
1115162565 14:30412330-30412352 CTGGCTGTGAAGATGGAAGAAGG - Intergenic
1116072627 14:40068150-40068172 CCTGCTTTGAAGATAGAGAAAGG - Intergenic
1116610613 14:47066715-47066737 GATAATCTGAAGATGGAAGAAGG + Intronic
1117433967 14:55698929-55698951 AGTACTCTGAAAATGGAAGATGG + Intronic
1118009218 14:61592369-61592391 CCAGCTTTGAAGGTGGAGGAAGG - Intronic
1118236266 14:64008108-64008130 GCTACTTTAAAAATGGAGGAGGG - Intronic
1118288854 14:64503168-64503190 CATAATTTGAAGATAGAAAAGGG + Intronic
1118315013 14:64720865-64720887 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1119882982 14:78116221-78116243 CCTAATTTGAAGGTGGAGGGAGG - Intergenic
1120266498 14:82257717-82257739 TTGACTTTGAAGATGGCAGAAGG + Intergenic
1120836540 14:89042898-89042920 CTGGCTTTGAAGATGGAGGACGG + Intergenic
1121016964 14:90554757-90554779 CCCACTTTGAACAAAGAAGAAGG + Intronic
1121546106 14:94764840-94764862 CCTAGTTTGCACATGGAAGATGG - Intergenic
1121572232 14:94955140-94955162 GCTACTTGGAAGATGGAGGTGGG - Intergenic
1121693617 14:95895118-95895140 CCTGCCTTGAAGCTGGACGAGGG + Intergenic
1121717009 14:96083582-96083604 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1121912029 14:97800373-97800395 AGGACTTTGAACATGGAAGATGG - Intergenic
1121988779 14:98534018-98534040 CTGACTTTCAAAATGGAAGAAGG - Intergenic
1122014588 14:98783612-98783634 CTGGCCTTGAAGATGGAAGAAGG + Intergenic
1122420927 14:101576886-101576908 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1123126651 14:105951780-105951802 TGGCCTTTGAAGATGGAAGAAGG + Intergenic
1123407161 15:20027881-20027903 TGGCCTTTGAAGATGGAAGAAGG + Intergenic
1123516491 15:21034537-21034559 TGGCCTTTGAAGATGGAAGAAGG + Intergenic
1124321940 15:28720120-28720142 CCTACTTTCAAGAATGAAAAAGG - Intronic
1124523041 15:30421958-30421980 CCTACTTTCAAGAATGAAAAAGG - Intergenic
1124535625 15:30544258-30544280 CCTACTTTCAAGAATGAAAAAGG + Intergenic
1124763027 15:32463338-32463360 CCTACTTTCAAGAATGAAAAAGG - Intergenic
1124775599 15:32585716-32585738 CCTACTTTCAAGAATGAAAAAGG + Intergenic
1124961413 15:34399014-34399036 CCTACTTTCAAGAATGAAAAAGG - Intronic
1124978039 15:34545238-34545260 CCTACTTTCAAGAATGAAAAAGG - Intronic
1125425272 15:39542543-39542565 TCAACTTTGAAGATGGAATGGGG - Intergenic
1126075060 15:44901086-44901108 CCAGCTTTCAAGATGGAGGAAGG - Intergenic
1126083303 15:44986735-44986757 CCAGCTTTCAAGATGGAGGAAGG + Intergenic
1127105940 15:55615127-55615149 CTGGCTTTGAAGATGGAAGGAGG + Exonic
1127210684 15:56771643-56771665 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1127591569 15:60430246-60430268 GTAACTTTGAAGATGGAGGAAGG + Intronic
1127617132 15:60697404-60697426 TGTACTTGGAAGATGGAAGAAGG - Intronic
1128041671 15:64580145-64580167 CTTAGTTTGAAGATGGAGGGAGG + Intronic
1128215464 15:65931252-65931274 CTGACTTTGAAGATGGAGGAAGG + Intronic
1128317148 15:66668139-66668161 CTGACTTTGAAGATGGAGGAAGG + Intronic
1130140988 15:81226195-81226217 CCTATGTTGAAAATGGCAGAAGG - Intronic
1130267344 15:82419370-82419392 CCTACTTTCAAGAATGAAAAAGG + Intergenic
1130504675 15:84527453-84527475 CCTACTTTCAAGAATGAAAAAGG - Intergenic
1130763492 15:86845953-86845975 CTTTCTTTCAAGAGGGAAGAAGG - Intronic
1130893841 15:88155296-88155318 CTGGCTTTGAAGATGGAAGAGGG + Intronic
1131771488 15:95742689-95742711 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1131931435 15:97446957-97446979 GCTACTTTCAACATGGAAAAGGG + Intergenic
1132319245 15:100913439-100913461 CTGGCTTTGAAGATGGAGGATGG - Intronic
1133214136 16:4280827-4280849 TGCACTTTGAAGATGGAGGAAGG - Intergenic
1133378843 16:5313131-5313153 CCCACTTTAAAGATGGGAGAAGG + Intergenic
1133467509 16:6042025-6042047 CTGGCTTTGAAGATGGAGGAGGG - Intronic
1133472612 16:6090110-6090132 CTGGCTTTGAAGATGGAAGAAGG - Intronic
1133904068 16:10004641-10004663 CTTGCTTTGAAGATGGAGGAAGG - Intronic
1133921999 16:10161820-10161842 TGCACTTTGAAGATGGAGGAAGG - Intronic
1134371846 16:13633288-13633310 TGTACTTTGCAGATGGAGGAAGG + Intergenic
1134764419 16:16744257-16744279 GTTGCTTTGAAGATGGAGGAAGG + Intergenic
1134823691 16:17267244-17267266 CCTACTTTGCAAATGTAAGGTGG + Intronic
1134981639 16:18614957-18614979 GTTGCTTTGAAGATGGAGGAAGG - Intergenic
1135527037 16:23221463-23221485 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1135723707 16:24838173-24838195 CCTACTAGGAATACGGAAGATGG + Intergenic
1135794762 16:25431271-25431293 CCTATTTTGATGTTGGAAGTTGG + Intergenic
1136571275 16:31098455-31098477 TCTGGTTTGAAGATGGAGGAAGG + Intergenic
1136592114 16:31223793-31223815 GCTACTTGGGAGATGGGAGATGG + Intronic
1137329333 16:47475293-47475315 TATATTTTGAAGATGGAAGTTGG + Intronic
1137525988 16:49236756-49236778 CCGGCTATGAAGATGGAGGAGGG + Intergenic
1138737436 16:59266625-59266647 CCTACTAAGTAGATGAAAGATGG + Intergenic
1138756902 16:59498118-59498140 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1138894542 16:61187714-61187736 TTGACTTTGAAGATGGAAGGAGG - Intergenic
1139154820 16:64427961-64427983 TAGACTTTGAAGATGGAAAAAGG - Intergenic
1140051632 16:71486491-71486513 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1140592998 16:76375463-76375485 CCTACTTTGAATATTGCATAGGG + Intronic
1140619299 16:76708506-76708528 CTGACGTTGAAGATGGAGGAAGG + Intergenic
1140700510 16:77577171-77577193 CTAGCTTTGAAGATGGAGGAAGG - Intergenic
1140706969 16:77639851-77639873 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
1140944078 16:79751218-79751240 GCTGGTTTGAAGATGGAGGAAGG + Intergenic
1140987915 16:80176724-80176746 CTGGCTTTGAAGATGAAAGAGGG + Intergenic
1141250948 16:82358602-82358624 GCTACTTTGAAGATGGAGGAAGG + Intergenic
1141304366 16:82847427-82847449 CTGACTTTGAAGATGGAGGAAGG - Intronic
1141507740 16:84489927-84489949 CCTGCTTCTAAGATGGCAGAGGG + Intronic
1142947617 17:3446056-3446078 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1143114775 17:4576325-4576347 CCTGCTTTGGAGGAGGAAGATGG + Intergenic
1143348193 17:6265908-6265930 CTGCCTTTGAAGATGGAGGAAGG - Intergenic
1143980711 17:10867195-10867217 TTCACTTTGAAGGTGGAAGAAGG - Intergenic
1145112566 17:20176684-20176706 TATACTCTGAAGAGGGAAGAAGG - Intronic
1145220162 17:21082026-21082048 ACTACTTTGCAGATGAAAAATGG + Intergenic
1145256134 17:21323493-21323515 CTTTCCCTGAAGATGGAAGAAGG - Intergenic
1145320479 17:21764457-21764479 CTTTCCCTGAAGATGGAAGAAGG + Intergenic
1146424347 17:32722470-32722492 CTGGCTTTGAAGATGGAAGGGGG - Intronic
1146491015 17:33282387-33282409 ATGGCTTTGAAGATGGAAGAGGG - Intronic
1146537831 17:33668439-33668461 CTGACTTTGAAGATGGAGGAAGG - Intronic
1146658810 17:34651221-34651243 ACTACTGGGAAGATGGAAGATGG - Intergenic
1146753215 17:35401058-35401080 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1149018224 17:51933391-51933413 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1149383180 17:56114897-56114919 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1150968909 17:70004362-70004384 CTGACTTTGAATATGGAAGAGGG - Intergenic
1152538314 17:80962870-80962892 TCTTCTTTGAGGATGGAAGATGG - Intronic
1153164208 18:2243570-2243592 CTGGCTTTGAAGATGGAAGAGGG - Intergenic
1153339230 18:3957225-3957247 CTGAGTTTGGAGATGGAAGAAGG + Intronic
1153382967 18:4458560-4458582 TGCACTTTGAAGATGGAGGAAGG + Intergenic
1153557447 18:6330435-6330457 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1153993652 18:10421648-10421670 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1154088101 18:11327149-11327171 CCAACTCTGAAGATGGAGGTAGG + Intergenic
1155361792 18:25010507-25010529 CCAGCTTTGAAGATAGAGGAAGG + Intergenic
1155677722 18:28449859-28449881 TGCACTTTGAAGATGGAGGAAGG - Intergenic
1155724769 18:29066978-29067000 CCTAGGTAGAAGATGAAAGAAGG + Intergenic
1155745260 18:29348601-29348623 CTGGCTTTGAAGATGGAAAAAGG - Intergenic
1155758047 18:29526609-29526631 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1155843398 18:30674789-30674811 CAAATTTTGAAGATGGAGGAAGG - Intergenic
1156093076 18:33494743-33494765 AGTGCTTTGAAGATGGAGGAAGG - Intergenic
1156161891 18:34369605-34369627 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
1156695582 18:39762241-39762263 CTGACTTTGAAGATGGAGAAGGG - Intergenic
1156829716 18:41477273-41477295 CCGGCATTGAAGATGGAAGAAGG - Intergenic
1157179817 18:45487227-45487249 CTGCCTTTGAAGATGGAGGAAGG - Intronic
1157737923 18:50067135-50067157 TCTACTATGAAGATGGAAGGGGG + Intronic
1158827353 18:61238055-61238077 TGCACTTTGAAGATGGAGGAAGG + Intergenic
1158872983 18:61706856-61706878 CCTACTCTGAAGACTGAAGGTGG - Intergenic
1159418288 18:68182407-68182429 CATACTGAGAAGATAGAAGATGG - Intergenic
1159702876 18:71651087-71651109 CCTAGTTTGCAGATAGCAGAGGG + Intergenic
1159816099 18:73075351-73075373 CTGACTTTGAAAATGGAGGAAGG - Intergenic
1159950110 18:74476687-74476709 TGCACTTTGAAGATGGAAGGAGG + Intergenic
1160298294 18:77657414-77657436 CCTACTTTCAAGGTGCAAGAGGG - Intergenic
1160319164 18:77874192-77874214 ACTCCTTTGAATATGGAAAAGGG - Intergenic
1160396038 18:78572836-78572858 CTGACTTTGGAGGTGGAAGAGGG + Intergenic
1161578418 19:5067463-5067485 CGTGCTCTGAAGATGGTAGAAGG + Intronic
1161693141 19:5749166-5749188 CCTACTTTGATTATGGAACTTGG - Exonic
1161806368 19:6445489-6445511 CTGGCTTTGAAGATGGAAGAAGG + Intronic
1161998094 19:7726794-7726816 CTGCCTTTGAAGATGGAAGAAGG + Intergenic
1163037911 19:14582112-14582134 CTGGCTTTGAAGATGCAAGAAGG - Intergenic
1163410971 19:17154315-17154337 CATAACTTGAAGATTGAAGATGG + Exonic
1165667387 19:37644778-37644800 AATATTTTGAAGATGGAAGAAGG + Intronic
1166145124 19:40828908-40828930 TGTGCTTTGAAGATGGATGAAGG - Intronic
1166284066 19:41812776-41812798 CTCGCTTTGAAGATGGAGGAAGG - Intergenic
1166398401 19:42459550-42459572 CTGGCTTTGAAGATGGAAGGGGG + Intergenic
1166601753 19:44101859-44101881 CTGCCTTTGAAGATGGAGGAAGG - Intronic
1166603571 19:44119498-44119520 CTGCCTTTGAAGATGGAGGAAGG - Intronic
1166845553 19:45725789-45725811 CCAACTTTGAATCTGGAAAATGG - Intronic
1168012039 19:53540807-53540829 GCAGCTTTGATGATGGAAGAAGG - Intronic
1168191387 19:54740910-54740932 CCAGCTTTGAAGGTGGAGGAAGG + Intronic
1168193656 19:54757538-54757560 CCAGCTTTGAAGGTGGAGGAAGG + Intronic
926443108 2:12910648-12910670 CTGGCTTTGAAGATGAAAGAAGG - Intergenic
927716741 2:25358144-25358166 CTGGCTTTGAAGATGGAGGAGGG + Intergenic
929227316 2:39524201-39524223 AAGACTATGAAGATGGAAGAGGG + Intergenic
929571502 2:43025892-43025914 CTGACTTTGAAGATGGAGGCAGG - Intergenic
929827900 2:45324013-45324035 ATGACTTTGAAGATGGAGGAGGG - Intergenic
930275712 2:49308797-49308819 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
931019997 2:58033400-58033422 TTGGCTTTGAAGATGGAAGATGG + Exonic
931052922 2:58434205-58434227 CTGACTTTGAAGATGGAGGAAGG - Intergenic
931191955 2:60010218-60010240 CCGGCTTTGAAAATGGAGGAAGG + Intergenic
931500263 2:62856985-62857007 CTGGCTTTGAAGATGGAGGAAGG + Intronic
932849273 2:75168478-75168500 CTGGCTTTGAAGATGGAGGAAGG + Intronic
933119412 2:78518265-78518287 CATAATTTCAAGATGGAAGATGG - Intergenic
933119549 2:78519700-78519722 CATAATTTCAAGATGGAAGATGG + Intergenic
933194349 2:79371626-79371648 CCTACTTTGCAGGAGGAACATGG + Intronic
935072039 2:99703243-99703265 CTGGCTTTGAAGATGGAAAAAGG - Intronic
935082389 2:99810870-99810892 CTGGCTTTGAAGATGGAAAAAGG - Intronic
935296795 2:101656733-101656755 CTGGCTTTGAAGATGGAGGAGGG + Intergenic
935391582 2:102558758-102558780 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
936505190 2:113100033-113100055 CCAGCTTTTAAGAAGGAAGAGGG - Intergenic
937265665 2:120613354-120613376 TCTACTTTGAAGAGGGAGCAGGG - Intergenic
937996905 2:127701281-127701303 CCTACTCCGAACAAGGAAGAGGG + Exonic
938081527 2:128372933-128372955 GCTACCTTGAAGCTTGAAGAAGG + Intergenic
938324454 2:130389061-130389083 CTAGCTTTGAAGATGGAGGAAGG - Intergenic
938710673 2:133973847-133973869 GGCACTTGGAAGATGGAAGAAGG - Intergenic
938998474 2:136705950-136705972 CTGACTTTGAAGATGGAGGAAGG + Intergenic
939230017 2:139412456-139412478 TACACTTTAAAGATGGAAGAAGG + Intergenic
939560874 2:143730120-143730142 GCTACTTTGAAGATATAAAAGGG + Intronic
939718446 2:145615774-145615796 CTCACTTTGAAGATGGAGAAAGG + Intergenic
940385439 2:153065766-153065788 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
940405210 2:153293436-153293458 ACTACCTTGAAGATGTAGGAAGG + Intergenic
940556920 2:155240543-155240565 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
941551928 2:166927524-166927546 CTGGCTTTGAAGATGGAAGAAGG - Intronic
942856042 2:180549837-180549859 CTGGCTTTGAAGAAGGAAGATGG - Intergenic
942889231 2:180966757-180966779 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
943070433 2:183134991-183135013 CTGACTGTGAAGATGGAGGAAGG - Intronic
943329966 2:186547266-186547288 TGTGCTTTGCAGATGGAAGAAGG - Intergenic
943426310 2:187739781-187739803 TTGACTTTGAAGATGGAGGAAGG - Intergenic
943645577 2:190405949-190405971 TGTGCTTTGAAGATGGAGGAAGG + Intergenic
943679537 2:190753309-190753331 TGTACTTTGAAGATGGAGGAAGG - Intergenic
943778383 2:191793311-191793333 CTCGCTTTGAAGATGGAAGAAGG - Intergenic
943852581 2:192744468-192744490 CTAACTTTGAAGATTGAGGATGG + Intergenic
943922351 2:193725226-193725248 CTGGCTTTGAAGTTGGAAGAAGG - Intergenic
943956538 2:194199120-194199142 CTTATTTTGAAGATGGAAGGGGG + Intergenic
943991764 2:194704746-194704768 CCTACTTTTTCGATGGAAGTAGG - Intergenic
944630852 2:201622558-201622580 CTGGCTTTGAAGATGGAAGAGGG - Exonic
945029881 2:205653285-205653307 CTGGCTTTGAAGGTGGAAGAAGG + Intergenic
945061798 2:205915818-205915840 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
945322016 2:208435556-208435578 CTGACTTCGAAGATGGAAGAAGG + Intronic
946449558 2:219768222-219768244 TGGACTTTGAAGATGGAAGAGGG + Intergenic
946693458 2:222327992-222328014 CCTACTTGGAAGACTGAGGAAGG + Intergenic
946798203 2:223379293-223379315 CCTTCTTTGAAGGTGGATGTTGG + Intergenic
946932370 2:224683493-224683515 CTGACTTTGAAGATAGAGGAAGG + Intergenic
947027188 2:225749647-225749669 CCTACTCTGAGGGTGGAGGATGG + Intergenic
947094329 2:226548979-226549001 CTGGCTTTGAAGATGGAAGGGGG - Intergenic
947364262 2:229378069-229378091 CTGACTTTGAAGAAGGCAGAAGG + Intronic
947457741 2:230270996-230271018 CAGGCTTTGAAGATGGAAGAAGG + Intronic
947468080 2:230372010-230372032 CAGGCTTTGAAGATGGAAGAGGG + Intronic
947979044 2:234393229-234393251 CTGGCTTTGAAGCTGGAAGAAGG - Intergenic
947987896 2:234464721-234464743 CTGGCTTTGAAGGTGGAAGAGGG - Intergenic
948115168 2:235490092-235490114 CTGACTTTGAAGATGCAGGAGGG - Intergenic
948273519 2:236691569-236691591 CCGGCTTTGAAGATGGAGGAAGG + Intergenic
948785552 2:240350609-240350631 CTGACGTTGAAGATGGAGGAGGG + Intergenic
1169133421 20:3180425-3180447 CTGGCTTTGCAGATGGAAGAAGG + Intergenic
1169798765 20:9494195-9494217 CCAACTTTCAAGAGGCAAGAAGG + Intergenic
1170045880 20:12084948-12084970 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1170129583 20:13004562-13004584 CTGACTTTGAAGATGGGGGAAGG + Intergenic
1170288776 20:14743929-14743951 TGAACTTTGAAGATGGAAGTAGG + Intronic
1170309460 20:14976372-14976394 TGTGCTTTGAAGATAGAAGAAGG - Intronic
1170402408 20:16002567-16002589 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1170866460 20:20162131-20162153 CCAGCTCTGAAGATGGAGGAAGG - Intronic
1172181340 20:33005556-33005578 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1173149853 20:40557656-40557678 CCGGCTTTGAAGATGGAGGAAGG - Intergenic
1173162923 20:40665652-40665674 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1173190743 20:40873855-40873877 CTGACTTTGAAGATGGAGGAGGG + Intergenic
1173573664 20:44095981-44096003 CCGGCTTTGAAGATGGAGGAAGG - Intergenic
1173676526 20:44840536-44840558 CCAGCTTTGAAGACGAAAGAAGG - Intergenic
1173796033 20:45860599-45860621 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1173932081 20:46829254-46829276 CTGGCTTTGAAGATGGAAGCAGG + Intergenic
1174505662 20:51015906-51015928 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1174539779 20:51279845-51279867 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1174911752 20:54615552-54615574 CTGGCTTTGAAGGTGGAAGAAGG + Intronic
1175175186 20:57107302-57107324 CTAACTTTGAAGGTGGAGGAAGG - Intergenic
1175189501 20:57201825-57201847 CCTCCTTTGAGAAGGGAAGAAGG - Intronic
1175287366 20:57845851-57845873 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1175385432 20:58591958-58591980 CCGACTCTGAAGGTGGAGGAAGG + Intergenic
1175508558 20:59505210-59505232 CCAGCTTTGAGGATGGAGGAAGG - Intergenic
1175691491 20:61068731-61068753 CTGGCTTTGAGGATGGAAGAAGG - Intergenic
1175921472 20:62452356-62452378 CCTACCTTGAGGAGGGCAGAGGG + Intergenic
1177256071 21:18664104-18664126 CTGACTTTGAAGATGGGAAAAGG - Intergenic
1177318415 21:19491077-19491099 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1177890499 21:26798652-26798674 GCTGCTTTGAAAATGGAGGAAGG - Intergenic
1178072970 21:28989655-28989677 CATAATTTGAAGAAGGGAGAAGG - Intronic
1178428827 21:32501465-32501487 CCTTCTTTGAAGCAGAAAGATGG + Exonic
1178751512 21:35308610-35308632 CCGGCTTTGAGGATGGAGGAAGG - Intronic
1178922069 21:36745252-36745274 CCTACTTAGAAGCAGAAAGAGGG - Intronic
1179140070 21:38717577-38717599 CTGGCTTTGAGGATGGAAGACGG + Intergenic
1179164854 21:38927362-38927384 CAGGCTTTGAAGATGGAGGAAGG - Intergenic
1179224223 21:39439195-39439217 CTGGCTTTCAAGATGGAAGAAGG + Intronic
1179964844 21:44796869-44796891 CTGGCTGTGAAGATGGAAGAAGG - Intronic
1180750043 22:18118213-18118235 CGTAATTAGAAGATGGAATAGGG + Intronic
1181550565 22:23636884-23636906 CTGGCTTTGAAGTTGGAAGAAGG + Intergenic
1182008273 22:26979431-26979453 CCTACTTGGAAGCTGGAAGGTGG + Intergenic
1182096432 22:27629144-27629166 CGTGCTTTGAAGATGGAAGAGGG - Intergenic
1182517314 22:30866279-30866301 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1183036227 22:35142822-35142844 CCTACATTTAGGATGGAAGTTGG + Intergenic
1184374611 22:44103762-44103784 CTGGCTCTGAAGATGGAAGAAGG + Intronic
1184422190 22:44388764-44388786 CTGGCTTTGGAGATGGAAGAAGG + Intergenic
949147630 3:721865-721887 CTGGTTTTGAAGATGGAAGAAGG + Intergenic
949312103 3:2711502-2711524 CCTACTTTTCTGAAGGAAGAAGG + Intronic
950838335 3:15942116-15942138 CTGGCTTTAAAGATGGAAGAAGG + Intergenic
950921584 3:16700277-16700299 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
951049407 3:18077407-18077429 CAAACTTTGAAGATCGGAGATGG + Intronic
951051378 3:18097707-18097729 CTGGCTTTGAAGATGGAGGAAGG - Intronic
951110130 3:18793392-18793414 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
951313296 3:21157312-21157334 CTGACATTGAAGATGGAGGAAGG - Intergenic
951593785 3:24295292-24295314 TATACTTCGAAGATGCAAGAAGG + Intronic
951594444 3:24301896-24301918 TTGACTTTGAAGATGGAGGAAGG + Intronic
952190466 3:31017774-31017796 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
952853557 3:37749213-37749235 CTGGCTTTGAAGATGGAAGGGGG - Intronic
953023155 3:39128819-39128841 CCAGCTCTGAAGAAGGAAGAAGG + Exonic
953294250 3:41696893-41696915 CTGGCTTTGAAGATGGAATAAGG + Intronic
953379445 3:42456465-42456487 CTGGCTTTGAAGATGGAGGAGGG + Intergenic
953581169 3:44157933-44157955 CTGACTTTGAAAATGGAAGGTGG + Intergenic
953900935 3:46843557-46843579 GCGGCTTTGAAGATGGAAGAAGG + Intergenic
954623731 3:52010750-52010772 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
954732000 3:52672191-52672213 CTGGCTTTGAAGATGGAGGAAGG - Intronic
954989235 3:54825255-54825277 CCTTCTGTGTAGAAGGAAGAAGG - Intronic
955413172 3:58668994-58669016 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
955514074 3:59709332-59709354 TGCACTTTGAAGATAGAAGACGG + Intergenic
955698328 3:61658493-61658515 CCTATTTTCAAGATAGAAAAAGG - Intronic
956504061 3:69918867-69918889 ACTATTTTGAATATGGAAAATGG + Intronic
957144054 3:76398869-76398891 CTGAGTATGAAGATGGAAGAAGG + Intronic
957791656 3:84949608-84949630 TCTACTTTGCAGATGAAAGATGG - Intergenic
958727588 3:97924648-97924670 TGCACTTTGAAGATGAAAGAAGG - Intronic
958970251 3:100603158-100603180 CAGACTTTGGAGATGGAAAATGG + Intergenic
959000671 3:100960697-100960719 CGGACTTTGAAGATGAAGGAAGG + Intronic
959013561 3:101107874-101107896 CTTCCTTTGAAGATGAAGGAAGG + Intergenic
959016833 3:101144211-101144233 GCTAGCTTGAAGATGGAGGAAGG + Intergenic
959029522 3:101281818-101281840 CTGTCTTTGAAGATGGAAGTGGG + Intronic
959123069 3:102255937-102255959 CTGGCTTTGAAGATGGAAGGAGG + Intronic
959322031 3:104888780-104888802 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
959585793 3:108023953-108023975 CTGGCTCTGAAGATGGAAGAAGG + Intergenic
959840939 3:110973723-110973745 TCTCCTTTGGAGATGGCAGAAGG + Intergenic
960085904 3:113591103-113591125 TATACTTTGCAGATGGAGGAAGG + Intronic
960305396 3:116054154-116054176 CTGGCTTTGAAGATGGAAGGTGG - Intronic
960636948 3:119793551-119793573 CTGGCTTTGAAGATGGAAGAAGG - Intronic
960743981 3:120865957-120865979 CTGGCTTTGAAGATGCAAGAAGG + Intergenic
960856952 3:122111584-122111606 CTAGCTTTGAAGATGGAAGGAGG + Intronic
961160143 3:124717236-124717258 CCTACTTTCAGGATGGATGATGG + Intronic
961181038 3:124877716-124877738 CCTACATCCAAGATGGCAGAGGG - Intronic
961529772 3:127533406-127533428 CCTACTTTTAAGTGGGCAGAGGG + Intergenic
961879505 3:130050925-130050947 CCTTCTTTGAAGCAGAAAGATGG - Intergenic
961990172 3:131181269-131181291 CTAGCTTTGAAGATGGAGGAAGG + Intronic
962021638 3:131508377-131508399 TTTACCTGGAAGATGGAAGAAGG + Intergenic
962528548 3:136257290-136257312 CTGGCTTTGAAGATGGGAGAAGG + Intronic
962904088 3:139786344-139786366 CATCTTTTGAAGATGGAGGAAGG + Intergenic
963268462 3:143262092-143262114 CCTGCCTTCAAGATGGGAGAGGG - Intergenic
963308621 3:143682763-143682785 CTGACTTTGAAGATGGAGGAAGG - Intronic
963422772 3:145082141-145082163 CCTACTTTTAAGTTAGAACAGGG + Intergenic
963463539 3:145648163-145648185 GCTACTTTGGGGATGGAAGGAGG + Intergenic
964143759 3:153433912-153433934 TGCACTTTGAAAATGGAAGATGG - Intergenic
964539296 3:157761489-157761511 TTGGCTTTGAAGATGGAAGAAGG + Intergenic
964561083 3:157997323-157997345 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
964702015 3:159578686-159578708 CTGACTTTGAAGATGGAAAAAGG - Intronic
965717081 3:171616642-171616664 CTGACTTTAAAGGTGGAAGAAGG + Intronic
966323435 3:178727625-178727647 CTGGCTTTGAAGATGGAGGAAGG + Intronic
966627063 3:182028823-182028845 CCTATTTTGCAGATGAAATAGGG + Intergenic
967346930 3:188467728-188467750 CTGGCTTTGAAGATGGAGGAAGG + Intronic
967588428 3:191242638-191242660 GCTACTTGGAAGATTGAGGAGGG - Intronic
967629236 3:191723913-191723935 TTGACTTGGAAGATGGAAGAAGG - Intergenic
968991717 4:3917829-3917851 CCTTCTTTGAAGCAGAAAGATGG - Intergenic
969049853 4:4365038-4365060 CTGCCTTTGAAGATGGAGGAAGG - Intronic
969206171 4:5647918-5647940 CCAGCTTTGGAGATAGAAGAAGG + Intronic
969726581 4:8921724-8921746 CTGACTTTGAGGATGGATGAAGG - Intergenic
969823626 4:9739659-9739681 CCTTCTTTGAAGCAGAAAGATGG + Intergenic
970044225 4:11831679-11831701 ATAACTTTGAAAATGGAAGATGG + Intergenic
970274480 4:14383305-14383327 CCAACTTTCTAGATGGAAGAAGG + Intergenic
970420494 4:15901509-15901531 CTGGCTTTAAAGATGGAAGATGG - Intergenic
970467889 4:16345969-16345991 CTGTCTTTGAAGATGGAAGAAGG - Intergenic
970774099 4:19652236-19652258 CGGGCTTTGAAGATGGAGGAGGG - Intergenic
970821882 4:20226272-20226294 CTGGCTTTGAAGATGGAGGATGG + Intergenic
971391808 4:26193024-26193046 CTGGCTTTGAAGATGGAAGAAGG + Intronic
971454925 4:26835227-26835249 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
971684784 4:29749860-29749882 TCTAGTTAGAAGCTGGAAGATGG + Intergenic
971795335 4:31219683-31219705 CCGGCTTTGAAGATGGAGAAAGG - Intergenic
971842700 4:31874662-31874684 CTGATTTTGAAGATGGAAAAAGG - Intergenic
971929361 4:33060292-33060314 TGCACTTTGAAGATAGAAGAAGG - Intergenic
972387998 4:38586448-38586470 CTGACTTTGAGGATGGAAGGGGG - Intergenic
972434116 4:39015442-39015464 CTGGCTTTGAAGATGGAAGGAGG + Intronic
972955075 4:44378981-44379003 CTGGCTTTGAAGATGAAAGATGG - Intronic
973184665 4:47311515-47311537 TGTGCTTTGAAGATGGAGGAAGG + Intronic
973628771 4:52798777-52798799 CTGACTTTGAAGATGGAGGATGG + Intergenic
974093292 4:57335002-57335024 CTGGCTTTAAAGATGGAAGAAGG + Intergenic
974160642 4:58133658-58133680 CTTATTTTGAAGATGGAGAAAGG + Intergenic
975634973 4:76439188-76439210 CAGACTTTGAAGATGGAGGAAGG - Intronic
975718915 4:77231507-77231529 GCTACTTTGGTGATGGAAAAGGG - Intronic
976223782 4:82779309-82779331 CTGGCTTTGAAGATGGAGGAAGG + Intronic
976392583 4:84520675-84520697 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
977149992 4:93499341-93499363 CCAATTTTGAGGATGGGAGAAGG - Intronic
977441980 4:97079417-97079439 CTGGCTTTGAAAATGGAAGAAGG - Intergenic
977464601 4:97368029-97368051 CTTGCTTTGAAGATGGAGGAAGG - Intronic
977610179 4:99022563-99022585 CACACTTTGAAGATAGAAGATGG + Intronic
977663177 4:99614700-99614722 CCTCATTCCAAGATGGAAGAAGG + Intronic
978133710 4:105232023-105232045 GATACTTTGAGGATGGGAGAAGG - Intronic
978306835 4:107338148-107338170 CTGACTTTGAGGATGGAAGATGG + Intergenic
978661039 4:111126619-111126641 CTGACTTTGAAGATGGAGGAAGG + Intergenic
979026172 4:115579152-115579174 CTGGCCTTGAAGATGGAAGAAGG + Intergenic
979043211 4:115826979-115827001 CTGGCTTTGAAAATGGAAGAAGG - Intergenic
979202425 4:117994222-117994244 CTAGTTTTGAAGATGGAAGAGGG - Intergenic
979503706 4:121468943-121468965 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
979845849 4:125510637-125510659 CTGACTTTGAAGATGGAGTAAGG - Intergenic
980029166 4:127805772-127805794 CCTCTTTTGAAGATGGAAGTGGG + Exonic
980082318 4:128357185-128357207 CTGGCTTTGAAGATGGAGGAGGG + Intergenic
980373279 4:131907885-131907907 CTATCTTTGAAGATAGAAGAAGG - Intergenic
980383749 4:132060525-132060547 CTGCCTTTGAAGAGGGAAGAAGG + Intergenic
980479800 4:133374209-133374231 TGTACTTTGAAGATGGAAGCAGG + Intergenic
980953973 4:139409542-139409564 TCAAGTTTGGAGATGGAAGAGGG + Intronic
980975948 4:139610623-139610645 CTTCCTTTGAAGATAGAAGATGG + Intergenic
981083831 4:140662295-140662317 CCTACTATGGAGCTGAAAGAGGG - Intronic
981291598 4:143082728-143082750 CTGACTTTGAAGATGGAAGAAGG + Intergenic
981781355 4:148434585-148434607 CCTACTTAGAAAAGGGCAGAAGG + Intronic
982507972 4:156243591-156243613 CTCACTTTTAAGATGGAAGGAGG + Intergenic
983378624 4:166962037-166962059 CCTTCTTTGAAGAAGGAAGGGGG - Intronic
984048263 4:174829849-174829871 CTTACTGTGAAGATGTAAAACGG - Intronic
984398848 4:179235666-179235688 TCTATTTTGCAGATGGAAAATGG + Intergenic
984709362 4:182872260-182872282 GCTGCTTTGCAGATGGAGGAAGG - Intergenic
987103231 5:14611402-14611424 CTGGCTTTGAAGATGGAGGAAGG + Exonic
987214117 5:15714932-15714954 CTGGCTTTGAAGATGGAACAGGG + Intronic
987385482 5:17325110-17325132 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
987724353 5:21678799-21678821 ACTACTTTGAAGATGGGTGTGGG + Intergenic
987960492 5:24802441-24802463 CTGACTTTAAAGATGGAAGAAGG - Intergenic
988330469 5:29832086-29832108 TCTACTAAGAAAATGGAAGAAGG + Intergenic
989415226 5:41167388-41167410 CCTACTTTTGAGAAGGAAAATGG - Intronic
990334867 5:54762698-54762720 CCAACTTTGGAGATGGAGGAAGG - Intergenic
990338871 5:54802580-54802602 CCTGGTCTGAAGATGCAAGATGG - Intergenic
990353410 5:54941043-54941065 CCAGCTTTGAAGATGGAGAAAGG - Intergenic
990605618 5:57406949-57406971 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
990662863 5:58037927-58037949 CTGGCCTTGAAGATGGAAGAAGG + Intergenic
990776662 5:59311985-59312007 CCTCCTTTGGAGGTGAAAGAGGG + Intronic
991111919 5:62910062-62910084 TGGACTTTAAAGATGGAAGAAGG - Intergenic
991122162 5:63029127-63029149 CTGGCTTTGAAGATAGAAGAGGG + Intergenic
991272020 5:64795573-64795595 CTGGCTTTGAAGATAGAAGAAGG - Intronic
991418001 5:66411369-66411391 CTGGCTTTGAAGATGGAAGGGGG + Intergenic
991419629 5:66427964-66427986 TTGCCTTTGAAGATGGAAGAAGG + Intergenic
991447042 5:66711442-66711464 TATGCTTTGAGGATGGAAGAAGG - Intronic
992107212 5:73459462-73459484 CCTACTTTGAAGGCTGAAGTGGG - Intergenic
992647871 5:78829014-78829036 CTGGCTTTGAAGATGGAGGAAGG + Intronic
993731555 5:91428837-91428859 CTGGCTTTGAAGATGGAAAAAGG + Intergenic
994106228 5:95952296-95952318 CCTACTTTGAGGGTGGAGGGTGG + Intronic
994780839 5:104088062-104088084 CTGAATTTAAAGATGGAAGAAGG - Intergenic
994997321 5:107080173-107080195 CTTACTTTGAGGGAGGAAGATGG - Intergenic
995060156 5:107804862-107804884 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
995060482 5:107807479-107807501 TCTATTTTGAAGATAGAGGATGG + Intergenic
995163460 5:109009332-109009354 CCTATTAAAAAGATGGAAGAGGG - Intronic
995335742 5:110997623-110997645 CCTACCATGAATATGGAAAAGGG - Intergenic
995412404 5:111873572-111873594 CTTGCTTTGAAGATGGAGGAAGG - Intronic
995572565 5:113495740-113495762 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
995647021 5:114324465-114324487 CAGGCTTTGAAGATGAAAGAAGG + Intergenic
995702990 5:114956341-114956363 CTGGCTTTGAAGGTGGAAGAAGG + Intergenic
995783519 5:115803260-115803282 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
996016391 5:118538611-118538633 CTCACTTTGCAGATGGAAGACGG - Intergenic
996351825 5:122552211-122552233 CTGTCTTTGAAGATGGAGGAAGG + Intergenic
996418265 5:123233481-123233503 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
996470427 5:123853624-123853646 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
996775786 5:127131027-127131049 TCTATTTTGAAGCAGGAAGATGG + Intergenic
996857897 5:128030567-128030589 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
996876521 5:128246415-128246437 CTTGCTTTGAAGATGGAGAAAGG - Intergenic
996960956 5:129249083-129249105 CCGGCTTTGAAGATGTAGGAAGG - Intergenic
997435011 5:133867683-133867705 CCTACTTTGCAGATGGGAAATGG + Intergenic
998131608 5:139654128-139654150 ACTGCTTTGAGGATGGGAGAGGG - Intronic
999403502 5:151285806-151285828 CTAGCTTTGAAGATGGAAGGCGG + Intronic
999966568 5:156816580-156816602 CCAGCTTTGAAGATGGAGGAAGG + Intergenic
1000248272 5:159468468-159468490 CCGGCCTTGAAGATGGAGGAAGG + Intergenic
1000413501 5:160959041-160959063 TGCACTTTGAAGATGGAAGCAGG + Intergenic
1000719784 5:164692540-164692562 TGTTCTTTGAAGATGGAGGAGGG + Intergenic
1001233910 5:170013528-170013550 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1001499762 5:172221391-172221413 CCTACTTGGAAGACTGAGGAAGG + Intronic
1001658161 5:173369983-173370005 CTGGCTTTGAAGATGGAGGATGG - Intergenic
1001658562 5:173373269-173373291 TGTGCTTTGAAGATGGAGGAAGG + Intergenic
1002447690 5:179299724-179299746 CTGGCTTTGAAGATGGAGGAGGG - Intronic
1002668082 5:180841751-180841773 CATACTATGAAAAAGGAAGAAGG + Intergenic
1003027672 6:2571333-2571355 TGGACTTTGAAGATGGAGGAAGG - Intergenic
1003418250 6:5932592-5932614 CTGACTTTGAAGGTGGAAGGGGG - Intergenic
1003626659 6:7747411-7747433 GCACCTTTGAAGATGGAGGAAGG + Intronic
1004888302 6:20072719-20072741 CTGGCTTTGAAGATGGAAGAGGG - Intergenic
1004905622 6:20234715-20234737 CTGGCTTTGAAGATGGAAGGGGG - Intergenic
1004998359 6:21216028-21216050 CTGACTTCGAAGATGGAAGCAGG + Intronic
1005347429 6:24904347-24904369 CTGACTTTGAAGATGGAGGAAGG - Intronic
1005403259 6:25457553-25457575 TCTACTTTGAATATGGGAGTTGG - Intronic
1005494770 6:26378741-26378763 GCTGCTTTGAAGATGGAGGAAGG - Intergenic
1005499249 6:26415639-26415661 GCTGCTTTGAAGACTGAAGAAGG - Intergenic
1005520725 6:26598371-26598393 CACACTTTGAAGATAGAAGTCGG - Exonic
1005728060 6:28669105-28669127 CTGTCTTTGAAGATGGAGGAAGG + Intergenic
1006010663 6:31040366-31040388 CAAGCTTTGAAGATGGAAGAAGG + Intergenic
1006206741 6:32350876-32350898 TTCACTTTGAAGATAGAAGAAGG + Intronic
1006773250 6:36571523-36571545 CTGACTTTTAAGATGGAGGAAGG - Intergenic
1007478014 6:42132030-42132052 CTGGCTTTGAAGATGGAAGGAGG + Intronic
1008036861 6:46754208-46754230 CCAAGTTTGAAGATGGGACATGG + Intronic
1008141697 6:47839464-47839486 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1008351379 6:50495113-50495135 CCTATTTTGCATATGGATGAAGG + Intergenic
1008416719 6:51249306-51249328 CTAGCTTTGAAGATGGATGAAGG - Intergenic
1009372333 6:62921617-62921639 CCAGCTTTGAAGATGAAGGAAGG - Intergenic
1009785501 6:68333138-68333160 CTGACTTTGAAGATGGAGGAAGG - Intergenic
1009887853 6:69645548-69645570 CCTGCTTTGAAGATGTAGGAAGG - Intergenic
1009965829 6:70577077-70577099 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1010374901 6:75156286-75156308 CCTATTTACAAGATGGGAGAAGG - Exonic
1010414695 6:75600325-75600347 CTGGCTTTGAAAATGGAAGAAGG - Intergenic
1012586433 6:100928594-100928616 CTAGCTTTGAAGATGGAGGAAGG - Intergenic
1013622279 6:111901468-111901490 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1013993605 6:116281203-116281225 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1014451983 6:121592399-121592421 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1014751536 6:125262308-125262330 TCTGCTTTGAAAATTGAAGATGG - Intronic
1014920757 6:127212368-127212390 CCTACTTTTAGCATGGAACAAGG - Intergenic
1015070370 6:129086943-129086965 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1015173060 6:130276122-130276144 CGTACTTTGAAAATAGAAGGAGG + Intronic
1016221120 6:141670875-141670897 CCTATTTTGAAGCTGTTAGATGG - Intergenic
1016908732 6:149176513-149176535 CCAGCTCTGAAGACGGAAGAAGG - Intergenic
1017099162 6:150832221-150832243 CTTACTTTGGAGAAGGAAGAAGG - Intronic
1017551898 6:155518279-155518301 CCTACCTTCAAGATGGCTGAAGG - Intergenic
1017632779 6:156413700-156413722 CTCATTTTGAAGATGGAAGACGG + Intergenic
1017756087 6:157530969-157530991 CCTACTTTGCAAAAGAAAGAAGG + Intronic
1018581888 6:165315085-165315107 CCGGCTTTGCAGATGGAGGAAGG - Intergenic
1019003247 6:168773449-168773471 CCGACTTTGAAGATGGAGGTTGG - Intergenic
1019844452 7:3483379-3483401 GCTATATTGAAGATGTAAGAAGG + Intronic
1020146798 7:5650647-5650669 CTGGCTTTGAAGATGGATGAAGG - Intronic
1020314523 7:6895611-6895633 CCTTCTTTGAAGCAGAAAGATGG - Intergenic
1020367954 7:7400393-7400415 TTGGCTTTGAAGATGGAAGAAGG + Intronic
1020527546 7:9281769-9281791 CCTGGTTTGTAGATGGCAGATGG - Intergenic
1020572045 7:9875852-9875874 CTAACTTTGAAGATGGAAGAAGG - Intergenic
1020999485 7:15310902-15310924 ACTCCTGCGAAGATGGAAGAGGG - Intronic
1021301734 7:18981597-18981619 CTGGCTTTAAAGATGGAAGAAGG - Intronic
1021787713 7:24169021-24169043 CTGGCTTTGAAGATGGAGGAGGG - Intergenic
1021881042 7:25095794-25095816 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1022871539 7:34485346-34485368 CCTGCTTTCAAAATGGAAGCAGG - Intergenic
1023030658 7:36087982-36088004 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1023310458 7:38881274-38881296 CTAGCTTTGAAGAGGGAAGAAGG - Intronic
1023381509 7:39612870-39612892 CCGGCTTTGGAGATGGAAGAGGG + Intergenic
1023994687 7:45152045-45152067 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1024234377 7:47386720-47386742 CCTACTTTGGGGATGAAAGCTGG - Intronic
1024740826 7:52352564-52352586 ACTTATTTGAAGATGGAAAAAGG + Intergenic
1024896672 7:54268824-54268846 CCTACTAAGAAAAAGGAAGAAGG - Intergenic
1025603814 7:63024474-63024496 GTTACTTGGAAGATGGGAGAAGG - Intergenic
1025946715 7:66110327-66110349 CTGCCTTTGAAGATGGAGGAAGG - Intronic
1026173890 7:67978613-67978635 TTTGCTTTGAAGGTGGAAGAAGG + Intergenic
1026228001 7:68459567-68459589 CCTCCTCTGAGGATGGAGGATGG + Intergenic
1026265446 7:68792231-68792253 CCACCTTTGAAGGTGGAAGATGG - Intergenic
1026649181 7:72200008-72200030 TCTTCTTTGAAGATTGAAGGGGG - Intronic
1026654934 7:72248451-72248473 CTGACTTTGAAGATGGTGGAAGG - Intronic
1026812886 7:73483751-73483773 GCTACTTTGGAGATGGAGGCAGG - Intronic
1027428835 7:78088991-78089013 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1027986952 7:85305174-85305196 CCTATTTGGAAGAAGGAACAGGG - Intergenic
1028032657 7:85935549-85935571 CTGACTTCAAAGATGGAAGAAGG - Intergenic
1028123637 7:87086087-87086109 CTGGCTTTGAAGATGGAAGATGG + Intergenic
1028150624 7:87367288-87367310 ATGGCTTTGAAGATGGAAGAAGG + Intronic
1028583934 7:92434696-92434718 TTGTCTTTGAAGATGGAAGAAGG + Intergenic
1028843658 7:95455383-95455405 CTGGCTTTGAAGATGGACGAAGG - Intergenic
1028953585 7:96664430-96664452 CTGTCTTTGAAGATGGAGGAGGG - Intronic
1029025896 7:97416823-97416845 CTGGCTTTGAAAATGGAAGAAGG - Intergenic
1029565060 7:101331232-101331254 GCTACTTGGAAGATGGAGGTGGG + Intergenic
1030360534 7:108590628-108590650 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1030552771 7:110985060-110985082 CCAACTTTGAAGATGGAAGAGGG + Intronic
1030629100 7:111875658-111875680 CTGACTTTGAAGATGGAGGAAGG + Intronic
1031206770 7:118768485-118768507 CTGGCTTTGAAGATGTAAGAGGG + Intergenic
1031647829 7:124248602-124248624 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1031721665 7:125184262-125184284 ACTACTTTAAAGTTGGAAGTTGG + Intergenic
1032879480 7:136074072-136074094 CCAGCTTTGAATATGAAAGAAGG + Intergenic
1033466208 7:141592342-141592364 CCAGCTGCGAAGATGGAAGAAGG - Intronic
1033575844 7:142683953-142683975 CACACTTTGAAGATGGAGGAAGG + Intergenic
1033619296 7:143048131-143048153 CTGGCTTTGAAGATGGACGAGGG + Intergenic
1034671000 7:152858465-152858487 CCTAAATTGAGGAGGGAAGAAGG + Intergenic
1036189833 8:6660300-6660322 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1036622087 8:10430932-10430954 TCTGCTTTGAACATGGAAGTTGG - Intergenic
1036625296 8:10466114-10466136 TTGACTTTGAAGATGGAGGAAGG + Intergenic
1037199696 8:16237426-16237448 CCTTCTTTTAAGATGGTAGTTGG + Intronic
1037358112 8:18044299-18044321 CTGACTTTGAAGATGGAAAAAGG - Intergenic
1037443883 8:18945386-18945408 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1039230348 8:35439705-35439727 CATATTTAGAAGATGGAAAAAGG - Intronic
1040902735 8:52433564-52433586 TGTGCTTTGAAGATGGAGGAGGG - Intronic
1041282604 8:56226448-56226470 CCTACTTTGTAGGTGCAAGATGG + Intergenic
1041337339 8:56801100-56801122 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1041396003 8:57391867-57391889 CTGACTTTGAAAATGGAGGAAGG + Intergenic
1041487967 8:58399765-58399787 CCTCCTTTCAAGATGGAACCAGG + Intergenic
1041800423 8:61792017-61792039 CCTACTTGGAAAATAAAAGATGG - Intergenic
1041957362 8:63570745-63570767 CTGACTTTGAAGATGGAGAAGGG + Intergenic
1041991002 8:63991627-63991649 CTTACTTTTAAGATGGAGGAGGG - Intergenic
1042109174 8:65361120-65361142 CTAGCTTTGAAGATGGAAGGAGG - Intergenic
1042216717 8:66435447-66435469 CCAGCTGTGAAGATGGAGGAAGG - Intronic
1042366924 8:67947814-67947836 CTGACTTTGAAGATGGAGGAAGG - Intergenic
1042708713 8:71691050-71691072 CTGACTTTGAAGATGGAGAAAGG - Intergenic
1042773299 8:72402225-72402247 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1042817691 8:72895381-72895403 CTGCCTTTGAAGGTGGAAGAAGG + Intronic
1043168632 8:76936061-76936083 CCAAATTTGAAGATGAAAAAAGG + Intergenic
1043481777 8:80660358-80660380 GCTACTTTGGAGATGGAGGCAGG + Intronic
1043510695 8:80947399-80947421 GCTGCTTTGCAGATGGAGGAAGG - Intergenic
1043730159 8:83668076-83668098 TCTACTTGGAAAATGGAGGAAGG + Intergenic
1044590615 8:93910772-93910794 CCAACATTGAAGATGGAGAAAGG + Intronic
1044744404 8:95358091-95358113 TCTCCTTTGAAAATGGAAAATGG + Intergenic
1044875218 8:96658746-96658768 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1044914925 8:97103002-97103024 TATACTTTGAAGATGGAAGAAGG - Intronic
1045000319 8:97872646-97872668 CTGGCTTTGAGGATGGAAGAAGG - Intronic
1045425159 8:102058911-102058933 CTGTCTTTGAAGATGGAGGAGGG + Intronic
1046097478 8:109578564-109578586 ATTACTTTGAAGATTGAAGGGGG + Intronic
1046237034 8:111437938-111437960 TTTGCTTTAAAGATGGAAGACGG - Intergenic
1046711549 8:117516972-117516994 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1047215652 8:122873850-122873872 CTGGCTTTGAAGATGGAAGGGGG - Intronic
1047467218 8:125128731-125128753 CCAGGTTTGAAGATGGAAGATGG - Intronic
1047688738 8:127329285-127329307 TGTACTTTGAAGATGGAGGCAGG + Intergenic
1047902274 8:129436321-129436343 CTGGCTTTAAAGATGGAAGAAGG + Intergenic
1048008649 8:130439169-130439191 CCGGCTTTGGAGGTGGAAGAAGG + Intronic
1048106840 8:131420268-131420290 CCTAGCTTAAAGATGGAAAATGG + Intergenic
1048247965 8:132830190-132830212 CTGACTTTGAAGATGGGAGCAGG - Intronic
1048360437 8:133692980-133693002 CATACTGGGAAGATGTAAGAGGG + Intergenic
1048894143 8:138974168-138974190 CTAGCTTTGAAGATGGAGGAAGG - Intergenic
1049452808 8:142671283-142671305 TGTGCTTTGAAGATGGAGGAAGG + Intronic
1050063931 9:1738850-1738872 CCTAATTTGGAGAAGGAGGAGGG - Intergenic
1050689492 9:8209260-8209282 CCTCCTTTGAAGCTGGGATATGG - Intergenic
1050768322 9:9164270-9164292 CTGACTTTGAAGATAGAGGAAGG - Intronic
1050931113 9:11327990-11328012 ATGGCTTTGAAGATGGAAGAAGG - Intergenic
1050962250 9:11749559-11749581 CCGACTTTGAAGATGGAGGAAGG - Intergenic
1051097863 9:13487185-13487207 TGTGCTTTGAAGATGGAGGAAGG + Intergenic
1051330895 9:16024051-16024073 TGCACTTTGAAGATGGAGGAAGG + Intronic
1051419810 9:16877815-16877837 CAGGCTTTGAAGATGGAAGGGGG - Intergenic
1052889459 9:33684757-33684779 GACACTTTGAAGATGGAGGAAGG + Intergenic
1053294998 9:36906401-36906423 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1053531737 9:38888876-38888898 CTGGCTTTGAAGATGGCAGAGGG + Intergenic
1053594810 9:39548973-39548995 CTGACTGTGAAGATGGAGGAAGG + Intergenic
1053638273 9:40038058-40038080 CTATCTTTGAAGATAGAAGAAGG - Intergenic
1053767809 9:41427165-41427187 CTATCTTTGAAGATAGAAGAAGG + Intergenic
1053852595 9:42304006-42304028 CTGACTGTGAAGATGGAGGAAGG + Intergenic
1054203961 9:62113304-62113326 CTGGCTTTGAAGATGGCAGAGGG + Intergenic
1054319067 9:63634658-63634680 CTATCTTTGAAGATAGAAGAAGG - Intergenic
1054546477 9:66338666-66338688 CTATCTTTGAAGATAGAAGAAGG + Intergenic
1054571443 9:66815994-66816016 CTGACTGTGAAGATGGAGGAAGG - Intergenic
1054634401 9:67475061-67475083 CTGGCTTTGAAGATGGCAGAGGG - Intergenic
1054793811 9:69280025-69280047 CCTACTGAGAAGATGGGATAAGG - Intergenic
1054960348 9:70961186-70961208 TGTGCTTTGAAGATGGAGGAAGG + Intronic
1054990187 9:71316588-71316610 CTGTCTTTGAAGATGGAAGGAGG + Intronic
1055031568 9:71775486-71775508 CCAATTTTGAAGATGTTAGATGG - Intronic
1055058964 9:72049253-72049275 CTGACTTTGAAGAGGGAGGAGGG - Intergenic
1055110115 9:72551055-72551077 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1055427046 9:76207020-76207042 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1056008319 9:82298581-82298603 TGTACTTTAAAGACGGAAGAAGG - Intergenic
1057533318 9:95874658-95874680 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1057841389 9:98488043-98488065 CTCACTTTGAAGATAGAGGAAGG + Intronic
1058146622 9:101419156-101419178 TTTACTCTGAAGAGGGAAGAGGG - Intergenic
1058157386 9:101530712-101530734 GCTACTTTGAAGATGTCAGATGG + Intronic
1058441992 9:105017920-105017942 TGTGCTTTGAAGATGGAGGAAGG - Intergenic
1059152613 9:111963153-111963175 CTGACTTTGAAGATGGAAGAAGG + Intergenic
1059462575 9:114443443-114443465 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1059466120 9:114469909-114469931 CCAGCCTTGAAGATGGAGGATGG - Intronic
1059990176 9:119857976-119857998 GCTGCTTTGAAGATGAAGGAAGG - Intergenic
1060046252 9:120343625-120343647 CTGGCTCTGAAGATGGAAGAAGG - Intergenic
1060112645 9:120917703-120917725 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1060921430 9:127423229-127423251 GCTACTTTGAAGTTGGAAGAAGG + Intergenic
1061292493 9:129659312-129659334 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1061384401 9:130279995-130280017 GCTGCTTTGAAGATGGAGGAAGG + Intergenic
1062173974 9:135150794-135150816 TCAGCTTTGAAGATGGAGGAGGG - Intergenic
1062545768 9:137063207-137063229 CCTACCCTGAAGATGGGAGTGGG - Exonic
1202786144 9_KI270719v1_random:21617-21639 CTATCTTTGAAGATAGAAGAAGG - Intergenic
1186052616 X:5614938-5614960 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1186166803 X:6835130-6835152 CCAACTTTGAAGATGAAGAAAGG + Intergenic
1186206772 X:7208920-7208942 CCAGCCTTGAAGATGGAGGAAGG - Intergenic
1186371555 X:8952335-8952357 CCTGCTTTGAAGACAGATGAAGG - Intergenic
1186421050 X:9426761-9426783 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1186584756 X:10860994-10861016 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1186624976 X:11283729-11283751 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1186633442 X:11376431-11376453 TTGACTTTCAAGATGGAAGAAGG + Intronic
1186667944 X:11737684-11737706 TGCACTTTGAAGATGGAAGAAGG - Intergenic
1186689977 X:11964943-11964965 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1186880152 X:13857008-13857030 CTGACTTTGAAGATGGAGAAAGG - Intronic
1187111257 X:16302966-16302988 CAGGCTTTGAAGATGGAAGAAGG + Intergenic
1187123595 X:16432919-16432941 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1187146807 X:16644596-16644618 CTGGCTTTGAAGATGGAGGATGG + Intronic
1187295863 X:17999907-17999929 CCAGTTTTGAAGATGGAAGAAGG - Intergenic
1187509190 X:19902259-19902281 CCGGCTTTGAAGATGGAAGGTGG + Intergenic
1188092969 X:25986159-25986181 GCCACTTTGAAGATGGAAGGGGG + Intergenic
1188266870 X:28087750-28087772 CTGGCTTTGAAGATGAAAGAAGG - Intergenic
1188299224 X:28487058-28487080 CTGGCTTTGAAGATGGATGAAGG - Intergenic
1188352832 X:29153122-29153144 CTAGCTTTGACGATGGAAGAGGG - Intronic
1188357982 X:29215971-29215993 CCAACTTTGCGGATGGAAGGAGG - Intronic
1188386417 X:29564966-29564988 GCTACTTGGAAGATGGAAAAAGG - Intronic
1188410913 X:29871107-29871129 CCGGTTTTGAAGATGGAAAAAGG - Intronic
1188434466 X:30145150-30145172 CTGACTTTGAAGACGGAGGAAGG + Intergenic
1188638510 X:32466731-32466753 CTGACTTTGAAGATGGAGGATGG + Intronic
1189097672 X:38157435-38157457 CTGTCTTTGAAGATGGAGGAAGG - Intronic
1189161552 X:38814214-38814236 CTGGCTGTGAAGATGGAAGAAGG + Intergenic
1189722298 X:43932863-43932885 CTAGCTTTGAAGATGGAGGAAGG - Intergenic
1190166088 X:48073979-48074001 TCAGCTTTGAAGATGGAGGAAGG - Intergenic
1190283001 X:48943536-48943558 ACTATTTTGAAGCTGGATGATGG + Intronic
1190576675 X:51846364-51846386 CCTACTTTGAAGATGGAAGATGG + Intronic
1190791630 X:53706064-53706086 CTGACTTTGAAGATGGAGGAGGG + Intergenic
1191901491 X:66045337-66045359 CTAACTTTGAAGATGGAGGAAGG + Intergenic
1192268101 X:69554308-69554330 GCTGCTTTGAAAATGGAGGAAGG + Intergenic
1193846058 X:86472300-86472322 CTGGCTTTGAACATGGAAGAAGG + Intronic
1193866472 X:86737982-86738004 CTGGCTTTGAAGATGGAAGAAGG - Intronic
1194960878 X:100234286-100234308 CTGACTTTGAAGATGGAGAAAGG + Intergenic
1195376752 X:104235073-104235095 CTAGCTTTGAAGATGGAGGAGGG - Intergenic
1195494196 X:105510721-105510743 CTGACTTTGAAGATGGTGGAAGG + Intronic
1195583584 X:106535994-106536016 CTGGCTTTGATGATGGAAGAAGG + Intergenic
1195929606 X:110061439-110061461 CCTACTAAGAAGATGGAAGGAGG - Intronic
1196265882 X:113646091-113646113 CCTACTGTGGAGGTGGAGGAGGG + Intergenic
1196560083 X:117135754-117135776 CTGGCTTTGAAGATGGAAGATGG + Intergenic
1196969635 X:121094919-121094941 CCGGCCTTGAAGATGGAAAAAGG - Intergenic
1196988269 X:121298883-121298905 CCTACTATGTATTTGGAAGAGGG + Intergenic
1197664949 X:129213588-129213610 GCTAGTAAGAAGATGGAAGACGG + Intergenic
1197812454 X:130458599-130458621 CATATTTTGATGATGCAAGAAGG - Intergenic
1198953274 X:142097587-142097609 CTGGCTTTGAAGATGGAAGAAGG - Intergenic
1199318908 X:146415099-146415121 CTGTCTTTGAAGATAGAAGAAGG + Intergenic
1199424783 X:147688518-147688540 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1199611635 X:149621750-149621772 TTGACTTTGAAGATGGAGGAAGG - Intronic
1199666016 X:150097130-150097152 CTTGCCTTGAAGATGGAGGAAGG - Intergenic
1199681612 X:150228489-150228511 TGTGCTTTGAAGATGGAGGAGGG - Intergenic
1199691083 X:150309468-150309490 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1199923208 X:152431790-152431812 CTGACTTTGAAGATGGGGGAAGG + Intronic
1201148033 Y:11076949-11076971 CCCACTTTGAAACTGGAGGAAGG - Intergenic
1201431409 Y:13906554-13906576 GCTTTTTTGAAGATGGAAGCAGG - Intergenic
1201578643 Y:15488065-15488087 CCAGCTTTGAAGATGGAGGAAGG - Intergenic