ID: 1190577648

View in Genome Browser
Species Human (GRCh38)
Location X:51856975-51856997
Sequence GACACTGGGGAGGTTCTCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 161}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190577642_1190577648 10 Left 1190577642 X:51856942-51856964 CCATAACTCTTGCAAAGGTTTTA 0: 1
1: 0
2: 2
3: 33
4: 277
Right 1190577648 X:51856975-51856997 GACACTGGGGAGGTTCTCATGGG 0: 1
1: 0
2: 1
3: 19
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190577648 Original CRISPR GACACTGGGGAGGTTCTCAT GGG Intronic
900552778 1:3264884-3264906 GACAGTGGGGATGGGCTCATTGG + Intronic
900627090 1:3613300-3613322 GGCACTGGGGAGGTTTTCTTGGG - Intergenic
900714576 1:4135966-4135988 GACAGTGGGTTGGTTATCATGGG + Intergenic
900714585 1:4136026-4136048 GACAGTGGGTTGGTTATCATGGG + Intergenic
900714670 1:4136564-4136586 GACAGTGGGTTGGTTATCATGGG + Intergenic
900714683 1:4136644-4136666 GACAGTGGGTTGGTTATCATGGG + Intergenic
900728061 1:4231411-4231433 AACACGGTGGAGGTTCTCACTGG + Intergenic
902078769 1:13806820-13806842 GGCAGAGGGGAGGGTCTCATAGG - Intronic
902512394 1:16973456-16973478 GGCTCTGGGGAAGTTCACATAGG + Intergenic
902810781 1:18886639-18886661 GGCACTGGGGAGGGTTTCATGGG - Intronic
904007386 1:27370605-27370627 GGCACTGGGCAAGTTCTCAGAGG - Exonic
905309947 1:37042423-37042445 GATACTGGGCAGGTTCTCTGGGG - Intergenic
906683399 1:47746739-47746761 GTCACTGGGGAGATTCACAGAGG + Intergenic
910369030 1:86496614-86496636 GACAGTGGGAAGGTTCTCAAAGG - Intronic
915610470 1:156988003-156988025 TACAGTGGGGAGGTTCTAAAAGG - Intronic
920570255 1:207010995-207011017 GATACTGGAGTGGTTCTCACAGG + Intronic
920652676 1:207850624-207850646 GACAGTTGGGAGTTTCTCTTTGG - Intergenic
920742867 1:208598024-208598046 GACACTGTGCAGGTTCACACTGG - Intergenic
921426461 1:215007335-215007357 GACACTGGCCAAGTCCTCATGGG + Intronic
922365635 1:224860915-224860937 AACAATGGGGAGGGTCTCCTAGG + Intergenic
924084844 1:240440324-240440346 GACTCTGAGGAGGCTGTCATGGG - Intronic
1064741974 10:18443258-18443280 GACACTAGGGTGTTTCTCACTGG - Intronic
1067077534 10:43196750-43196772 GCCACTGGAGAGGGTCACATGGG - Intronic
1067852249 10:49761570-49761592 GACACTGGGGAGGGGCTGCTAGG + Intronic
1068706248 10:60079117-60079139 TACACTGGGGAAGTTTTCTTTGG - Intronic
1069359483 10:67625260-67625282 GACACTGAGTAGGTCCTCCTGGG - Intronic
1071121797 10:82287219-82287241 GATACTGAGTAAGTTCTCATGGG + Intronic
1073368657 10:102967056-102967078 GATACTGGGGAGGCTGACATGGG - Intronic
1073790174 10:106932060-106932082 TACCCTGGGGATGTTCTCATGGG + Intronic
1074563160 10:114552439-114552461 GACACTGGCAAGTTCCTCATGGG - Intronic
1074936015 10:118182256-118182278 GAACCTGGGGAGGTTGTCAGTGG - Intergenic
1077178353 11:1200727-1200749 GACATATGGGAGGTTCTCCTTGG - Intronic
1078105628 11:8356468-8356490 GACAGTGGTGAGGTTTTCGTGGG + Intergenic
1078539393 11:12201001-12201023 GACACTGGTGAGGTTTGCTTTGG - Intronic
1079478743 11:20858863-20858885 GTCACAGGGGAGCTTCTAATAGG - Intronic
1082621122 11:55423654-55423676 GACATTGGGGCAGTTCTCAAAGG - Intergenic
1090931414 11:131301207-131301229 AACAATGTGGAGGTTTTCATGGG - Intergenic
1092856999 12:12683770-12683792 GACCCTGGGGAAGTTCTCAAAGG - Intronic
1093522661 12:20068362-20068384 TAGACTGGGGAAGTTCTCCTGGG - Intergenic
1095551002 12:43439521-43439543 GACAGTGGGGAGGATTCCATAGG + Intronic
1098744445 12:74218206-74218228 GACACTGAGTAGGTCCTCCTGGG - Intergenic
1100963199 12:99985170-99985192 GACACTGGGGAGGGGCCCTTTGG + Intergenic
1102498069 12:113333174-113333196 GGGACTGGGTAGGTTTTCATGGG - Intronic
1104410836 12:128556377-128556399 AACACTGTGCAGGTTCTCATGGG - Intronic
1108462853 13:50684524-50684546 GAGTCTGGGGAGGTTCTGAGTGG + Intronic
1109141311 13:58716115-58716137 GGCACTGGGTAGGCTCTCCTGGG - Intergenic
1111569457 13:90063296-90063318 GACACTAGTGAAGTTTTCATAGG + Intergenic
1113223012 13:108127109-108127131 GACACTGGTGTTGTTCTCACAGG - Intergenic
1115105462 14:29756567-29756589 GACACTGGGCAGTTTCTGGTGGG - Intronic
1115790049 14:36868333-36868355 GTCTCTGGGGAGGTTCTCAAAGG + Intronic
1117115256 14:52504157-52504179 TAGACTGGGGAAGTTCTCCTGGG - Intronic
1117646033 14:57853860-57853882 GACACCGGGGAGTCTCTCATGGG - Intronic
1117653496 14:57930505-57930527 GACAATGAGGAAGTTTTCATAGG - Intronic
1119884617 14:78129939-78129961 GAGACTGGGGAGGTTGGCAGGGG - Intergenic
1120205482 14:81582856-81582878 GACAGAGGGGAGGTTATCTTGGG - Intergenic
1122766138 14:104071792-104071814 GACACTGTTGAGATTCTAATTGG - Intergenic
1122921974 14:104884101-104884123 GACACTGGGGCGGTCCCTATCGG - Exonic
1123449693 15:20351931-20351953 GACGCTGGGGAGGGTCACCTTGG - Intergenic
1124053254 15:26218607-26218629 GACGCTGGGGAGCTTTTCAAGGG + Intergenic
1130321266 15:82844087-82844109 GACACTGCGGAACTGCTCATGGG + Intronic
1130980140 15:88806744-88806766 GACTCTAGGCAGGGTCTCATGGG - Intronic
1131739337 15:95370288-95370310 GTCACGGGAGCGGTTCTCATGGG + Intergenic
1133565631 16:6990928-6990950 AACAATGTGGTGGTTCTCATTGG - Intronic
1134308368 16:13053922-13053944 GACTCTGGGGAGGGTATCAGTGG - Intronic
1141676789 16:85522004-85522026 GGCTCTGGAGAGGTTCCCATGGG - Intergenic
1141752048 16:85965050-85965072 TAAAATGGGGAGGTGCTCATTGG - Intergenic
1143180212 17:4979958-4979980 GACAGTGGGGAGGAGCTCAAGGG - Exonic
1143634508 17:8156600-8156622 GACACTTCTGAGGTTCTTATTGG + Intronic
1144228650 17:13176653-13176675 CACACTGGGCATGTTCTCATGGG + Intergenic
1144508097 17:15850630-15850652 GCTGCTGGGGAGGTCCTCATTGG - Intergenic
1146920634 17:36707878-36707900 GACACTGGTGAGGGGCTCATGGG + Intergenic
1148130198 17:45257695-45257717 GAGATGGGGGAGGTTCACATGGG - Intronic
1150655676 17:67037832-67037854 GATAGTGAGGAAGTTCTCATGGG - Intergenic
1152338945 17:79713957-79713979 GACGCTGGGGAGGGTCACCTTGG + Intergenic
1152585168 17:81186046-81186068 GACACTGTGGAGGTCCTCAGGGG - Intergenic
1153080574 18:1218930-1218952 GTCTCTGGGGAGATTCTCAGAGG - Intergenic
1159324197 18:66893805-66893827 GACACTGGGGAGGCTTTTAATGG + Intergenic
1160274666 18:77420535-77420557 TAGACTGGGGAAGTTCTCCTGGG + Intergenic
1160338030 18:78060094-78060116 GACACCGGGGAGCTTCTCCTGGG + Intergenic
1161827579 19:6579040-6579062 GTCACAGGGGAGGTTATCTTGGG + Intergenic
1161968238 19:7560982-7561004 GACACTGGTGAGGCTCTTAGGGG - Intronic
1162569517 19:11463145-11463167 GACACAGAGGAGGTTTTCACAGG + Intronic
1163647565 19:18498580-18498602 GTCATTGGGGAGGGTCTCACAGG - Intronic
1163696263 19:18765074-18765096 GCCCCTGGGAAGGCTCTCATTGG + Intronic
1166816708 19:45550677-45550699 GAAACTGGGAGGGTTCTGATGGG - Intronic
926912813 2:17866977-17866999 AGCACTGAGGAGGTTCTCAAAGG + Intergenic
927033004 2:19141814-19141836 GACCCTGGGGAGCTCCTGATGGG - Intergenic
927967981 2:27283700-27283722 GCTACTGGGGAGGTTCTAGTAGG + Intronic
930184399 2:48397983-48398005 CACACAGGGGAGGTTCTGCTTGG - Intergenic
933049965 2:77590791-77590813 GAGCAGGGGGAGGTTCTCATCGG - Intronic
933251743 2:80036681-80036703 GACAGCAGGGAGCTTCTCATGGG + Intronic
933760169 2:85667233-85667255 TCCAATGGGGAGGTTCTCTTAGG + Intronic
941739840 2:169023815-169023837 GAGACTGGGGAGGGGCTCAGAGG + Intronic
941885516 2:170523513-170523535 GTCACTGGTGATGTTCTCATTGG + Intronic
944909573 2:204296447-204296469 CCCACTGGGGAGGTCGTCATAGG + Intergenic
948602290 2:239114224-239114246 GAAGCTGGGGAGGTGCTCAACGG + Intronic
948911041 2:241002848-241002870 GGCATTGGGGAGGCTCTCAGGGG - Intronic
1172170762 20:32930530-32930552 GACAATGGGGATGTTGTCGTGGG + Intronic
1172286425 20:33743830-33743852 GACACAGAGGAGGTTCTCAATGG - Intronic
1175396775 20:58669870-58669892 GACCCTGGGGAGGTTTTCTCAGG - Intronic
1175880373 20:62254528-62254550 GACACTGGAGAGTCTCTCAGGGG + Intronic
1176265176 20:64205469-64205491 GACCCTCGGGAGGGGCTCATGGG + Intronic
1176383664 21:6126517-6126539 TCCACTGGGGAGGTCCTGATGGG + Intergenic
1179414637 21:41188401-41188423 GACTCTGGGGTGGTTTGCATAGG - Intronic
1179739806 21:43411721-43411743 TCCACTGGGGAGGTCCTGATGGG - Intergenic
950359514 3:12440707-12440729 AACACTGGACAGGTCCTCATGGG - Intergenic
951458639 3:22923261-22923283 GCCAATCGGGAGGTTTTCATCGG - Intergenic
953251588 3:41249339-41249361 CACACTGGGAAGGATCTCAGTGG + Intronic
953492764 3:43364512-43364534 CAAAGTGGGGAGGTTCTCTTGGG + Intronic
954772008 3:52979494-52979516 CACACATGGGAGGTTTTCATGGG + Intronic
955778537 3:62459760-62459782 GACACTGGGGGGGTTAGCAATGG - Intronic
955780743 3:62481827-62481849 CACATTGGGTAGGTTCACATTGG + Exonic
956289604 3:67647709-67647731 GGCAGTGGGGAGGAGCTCATGGG - Intronic
959041369 3:101426168-101426190 TAGGCTGGGGAAGTTCTCATGGG - Intronic
960758627 3:121048398-121048420 GAGGCTGGGGACGTTTTCATGGG + Intronic
960994050 3:123329540-123329562 GATGCTGGGCAGGTTCCCATGGG - Intronic
962412398 3:135152663-135152685 GCCACTGGGGAGTCTCTGATTGG + Intronic
968504171 4:964367-964389 GACACCTGGGGGGTCCTCATGGG + Intronic
968802576 4:2752951-2752973 GACACTCGGGAGGCTGTGATGGG + Intronic
970256843 4:14177072-14177094 GACACTGGAGAGGTCATCAGTGG + Intergenic
970633955 4:17986308-17986330 GAGGTTGGGGAGGTTTTCATGGG + Intronic
970805371 4:20024512-20024534 GACACTGACAAGGTTCTCAGAGG + Intergenic
976508756 4:85882702-85882724 GAGAATAGAGAGGTTCTCATAGG + Intronic
989770603 5:45140127-45140149 GATACTGGGTAAGTTCACATGGG + Intergenic
990415932 5:55586716-55586738 GATTCTGGGGAGGTAGTCATAGG + Intergenic
992084927 5:73269879-73269901 GAAACTGAGGAAGTTCTTATGGG - Intergenic
992672922 5:79077498-79077520 GAGAGTGGGGAGGTTGTGATTGG + Exonic
993397340 5:87406552-87406574 GACACTCAGGAAATTCTCATTGG + Intronic
1002942532 6:1730696-1730718 GACACTGGGGAGGCTCCTCTGGG + Intronic
1004450899 6:15745282-15745304 TACACTGAGGAGATTCTAATTGG + Intergenic
1004803216 6:19173848-19173870 GACACTGGGGAGTTTCTAGGGGG + Intergenic
1006779747 6:36624281-36624303 GACACTTGAGGGGTTCTAATGGG + Intergenic
1007708354 6:43805355-43805377 GGCCCTGGGGAGGTTGTCAGAGG - Intergenic
1007973872 6:46080497-46080519 GACCCTGGGGATTTCCTCATTGG + Intergenic
1014336971 6:120148602-120148624 AAGACTGGGGAGGTTTTCCTCGG - Intergenic
1016589632 6:145729964-145729986 GATAGTGAGTAGGTTCTCATGGG + Intronic
1017325450 6:153136477-153136499 GAGACTGGAAAAGTTCTCATGGG + Intergenic
1018044651 6:159955063-159955085 GGCCCTGGGGAGGTACACATTGG - Intergenic
1018595454 6:165475376-165475398 GAGAATGGGGAGATTTTCATAGG - Intronic
1021201156 7:17729759-17729781 GACACTGGGTAGGCCCTCCTAGG - Intergenic
1022863268 7:34390124-34390146 GACACTGGGTAGGCCCTCCTGGG - Intergenic
1023002809 7:35828960-35828982 GACACTAGAGAGTTTTTCATAGG - Intronic
1024046098 7:45586807-45586829 AGCACTGGGCATGTTCTCATTGG - Intronic
1024820740 7:53327093-53327115 GGCAAAGGGGAAGTTCTCATTGG + Intergenic
1025189236 7:56884084-56884106 GAGACTGGTGAGGTTCTCACCGG + Intergenic
1025682704 7:63692833-63692855 GAGACTGGTGAGGTTCTCACCGG - Intergenic
1026066889 7:67082668-67082690 GACACTGGGGAGCTGGTCCTTGG + Intronic
1026612919 7:71876254-71876276 GACACTGGGTTAGTTCTCGTGGG + Intronic
1026710031 7:72729673-72729695 GACACTGGGGAGCTGGTCCTTGG - Intronic
1029327859 7:99825072-99825094 GACACTGGGTAGGTTCTCCGGGG + Intergenic
1029665040 7:101989630-101989652 GAGACTGGTGAGATTCTCACCGG + Intronic
1034503501 7:151467510-151467532 GACACTGGGGTGGGGGTCATGGG - Intronic
1035486096 7:159227157-159227179 GACCCTGAGGAAGTTTTCATGGG + Intergenic
1037164116 8:15806261-15806283 CAGTCTGGGGATGTTCTCATTGG + Intergenic
1037234131 8:16696477-16696499 TACACTGGAGAAGTTCTCTTCGG - Intergenic
1038363968 8:26912019-26912041 GACACTGGGGTGGTGGCCATGGG + Intergenic
1040559741 8:48514054-48514076 GACACTGTGAAGGTTTTCTTTGG + Intergenic
1040626717 8:49158102-49158124 GAGACTGGGTTGGTTCTCAAGGG - Intergenic
1041911460 8:63093319-63093341 GACACTGGGTAGCTTCTCCTGGG + Intergenic
1042752081 8:72169263-72169285 GACATTGGGGATATTTTCATGGG + Intergenic
1043739268 8:83789454-83789476 GACAATGGGGAGGTTCTAATGGG - Intergenic
1044293851 8:90504353-90504375 GACACTGGGAACTTGCTCATGGG - Intergenic
1048843975 8:138589303-138589325 CACACTGGGAAGGGTCACATTGG + Exonic
1049034416 8:140063108-140063130 GATAGTGGGTGGGTTCTCATAGG - Intronic
1051874127 9:21772652-21772674 GACATTGGGGACTTTCTCATTGG + Intergenic
1056642879 9:88386438-88386460 GCCACTGGTGATGATCTCATTGG - Intergenic
1059726352 9:117012237-117012259 GGAACTGGGGAGGTTCTGAAGGG - Intronic
1062723670 9:138058914-138058936 GACAGTGGGGAGGTTCTGGGAGG + Intronic
1187842070 X:23499266-23499288 GACACTGGGTAGGCCCTCCTGGG - Intergenic
1188086824 X:25909119-25909141 GAAACTGGGGAGGTTTTTCTAGG - Intergenic
1189743437 X:44144869-44144891 GCCACTGTGGAGTTTTTCATCGG + Intergenic
1190577648 X:51856975-51856997 GACACTGGGGAGGTTCTCATGGG + Intronic
1192360420 X:70435313-70435335 GACCCGGGGGAGCTGCTCATTGG + Intergenic
1193802766 X:85956160-85956182 AACACTGGGGGAGTTCTCCTTGG + Exonic
1194605038 X:95967895-95967917 AACAGTGAGGAGGTTCTCTTTGG - Intergenic
1194939594 X:99994017-99994039 GACAGAGGTGAGGTTCCCATGGG + Intergenic
1195336304 X:103858277-103858299 GACATTGGGGAGGTGATTATAGG + Intergenic
1195418398 X:104645354-104645376 GACACTGGTGAGGTGATCAGGGG - Intronic
1197290705 X:124653738-124653760 GACACTGGAGAAGTTGACATTGG - Exonic
1197979079 X:132196903-132196925 GACACTGGGGAGCTTTTGACTGG + Intergenic
1199561063 X:149162818-149162840 TACGTTGGGGAAGTTCTCATGGG - Intergenic
1201479096 Y:14418218-14418240 GGCAGTGGGGAGGTTATCTTGGG + Intergenic