ID: 1190580032

View in Genome Browser
Species Human (GRCh38)
Location X:51883370-51883392
Sequence CCACTCTGCTTGGGAGAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 5, 3: 27, 4: 225}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190580032_1190580038 13 Left 1190580032 X:51883370-51883392 CCAGTCTCTCCCAAGCAGAGTGG 0: 1
1: 0
2: 5
3: 27
4: 225
Right 1190580038 X:51883406-51883428 TGGAACTGTCACTTAGCCCATGG 0: 1
1: 0
2: 0
3: 8
4: 111
1190580032_1190580037 -7 Left 1190580032 X:51883370-51883392 CCAGTCTCTCCCAAGCAGAGTGG 0: 1
1: 0
2: 5
3: 27
4: 225
Right 1190580037 X:51883386-51883408 AGAGTGGTACTGGTAAAAGCTGG 0: 1
1: 0
2: 1
3: 11
4: 129
1190580032_1190580039 20 Left 1190580032 X:51883370-51883392 CCAGTCTCTCCCAAGCAGAGTGG 0: 1
1: 0
2: 5
3: 27
4: 225
Right 1190580039 X:51883413-51883435 GTCACTTAGCCCATGGTGACAGG 0: 1
1: 0
2: 1
3: 4
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190580032 Original CRISPR CCACTCTGCTTGGGAGAGAC TGG (reversed) Intronic
900664761 1:3807755-3807777 CCACTGTGCCTGGCTGAGACTGG + Intergenic
902810024 1:18882915-18882937 CCTCTCTGCCTGGGAGACCCTGG - Intronic
906303765 1:44703220-44703242 CTACTCTGATTGGGGGAGAGAGG - Intronic
906478235 1:46184176-46184198 CCACACAGCTGGGGAGAGAGAGG - Exonic
907121438 1:52011453-52011475 CCACTCTGTTTTGTAGAGACGGG + Intergenic
909864185 1:80645884-80645906 CAACTCTGCTTATGAGATACTGG + Intergenic
911244448 1:95501205-95501227 CAACACTGCATGGGACAGACTGG - Intergenic
911469809 1:98303888-98303910 CCACTCTCCTTGGAAGTGCCTGG + Intergenic
913570463 1:120114820-120114842 CCACTCTGTGGAGGAGAGACAGG + Intergenic
913702317 1:121385074-121385096 CCACACTGATGGGGATAGACTGG - Intronic
914042880 1:144065570-144065592 CCACACTGATGGGGATAGACTGG - Intergenic
914135206 1:144894918-144894940 CCACACTGATGGGGATAGACTGG + Intronic
914706162 1:150171624-150171646 CCACTGTGCTTGGCAGAGAAGGG - Intergenic
915050930 1:153071568-153071590 CCGATCTGCTTTGGAGAAACTGG - Intergenic
915671068 1:157489503-157489525 CCATTCTTCCTAGGAGAGACAGG + Intergenic
917508126 1:175647659-175647681 CCACTGTGCTTTGGAAAGCCTGG + Intronic
917964180 1:180168109-180168131 TGACTCTGCCTGGGAGAGGCTGG + Intronic
919473504 1:198007958-198007980 CCATTGTGGTTGGGGGAGACTGG + Intergenic
920489743 1:206403816-206403838 CCACACTGATGGGGATAGACTGG - Intronic
921058565 1:211563449-211563471 CCACTCTGCTGGGGTGAGAGTGG + Intergenic
924477915 1:244397521-244397543 CCACTGGGATTGGGAGACACTGG + Intergenic
1063602782 10:7497259-7497281 TCCACCTGCTTGGGAGAGACAGG - Intergenic
1064269532 10:13852394-13852416 CCACCATGCCTGGTAGAGACAGG + Intronic
1064274403 10:13892710-13892732 CCACTCTTCAGGGGAGAGACTGG + Intronic
1064327689 10:14365991-14366013 CCACTCTAGTTGAGAGAGAAAGG - Intronic
1065207444 10:23370527-23370549 TAACTCAGCTTGGGAGAGAAAGG + Intergenic
1066073545 10:31847626-31847648 ACACTCTGCTTGGGATAGGGTGG + Intronic
1068597726 10:58921412-58921434 ACACTCTGGTAGGGAGAGACTGG - Intergenic
1070782065 10:79143407-79143429 CAACTCTGCTGTGGAGAGAGGGG - Intronic
1072340980 10:94449481-94449503 CCATTATGCTTGGGATAGACAGG - Intronic
1072860128 10:98994844-98994866 CCACTCTGCCAAGGAGGGACAGG - Intronic
1074078972 10:110152573-110152595 CAAGGCTGCTTGGGAGAGCCTGG + Intergenic
1074876913 10:117620918-117620940 CCACTCATCGTGGGAGAGACAGG - Intergenic
1074909082 10:117891228-117891250 TCATTCTGCTTGAGAGAGAAAGG + Intergenic
1077381078 11:2237922-2237944 CCACTCTCCTTTGGAGAGACAGG + Intergenic
1077959818 11:7063675-7063697 CCACTCTGATTAACAGAGACTGG + Intronic
1078319120 11:10318039-10318061 CCCCTGTGTTTGGGAGGGACTGG + Intronic
1081397765 11:42607046-42607068 CCACTGTCCATGGGACAGACAGG - Intergenic
1081623137 11:44630916-44630938 CCACTCTGCTTAGGAGGAAATGG + Intergenic
1083998280 11:66282880-66282902 CCACTCTACTTGGGAGGGAGTGG + Intronic
1084042056 11:66547914-66547936 CCCCTCTACTTGGGAAAGTCTGG - Intronic
1084231246 11:67754991-67755013 GCACTCAGCTTGGGTGAGAAGGG - Intergenic
1084351254 11:68601442-68601464 CCACACTGCCTGGGAGAGACTGG - Intronic
1089338979 11:117744908-117744930 CCTCCCTGCTGGGGTGAGACAGG - Intronic
1091703138 12:2677292-2677314 CCAGCCTGCTGGGGAGGGACCGG - Intronic
1091838112 12:3600295-3600317 CCTCTCTCCCTGGGAGAGCCCGG - Intergenic
1093521176 12:20051767-20051789 CCACTGTAGTGGGGAGAGACAGG + Intergenic
1096227002 12:49872447-49872469 GCACTCTGCTTGGTAGACAGGGG + Intronic
1096339448 12:50785169-50785191 CCCCTCTGCTTGGGAGGCTCAGG + Intronic
1097753754 12:63386568-63386590 CATCTCTGCTTGGGAGAGAGGGG - Intergenic
1098845348 12:75528518-75528540 CATCTCTGCTTGGCACAGACTGG + Intergenic
1103784237 12:123420310-123420332 CCACTGCGCCTGGCAGAGACGGG + Intronic
1103868495 12:124073277-124073299 CCACTCTGCCTGGCAAAGAACGG + Intronic
1105681943 13:22736973-22736995 CCTCTCTGCTTGGGAAACCCTGG - Intergenic
1106667668 13:31869689-31869711 CCACTGTACTTGTGAGATACTGG - Intergenic
1107203490 13:37751823-37751845 TCACTTTGCTTGGGAGATACAGG - Intronic
1108583337 13:51845988-51846010 CCAGTCTACTGGGGAGGGACTGG + Intergenic
1112880882 13:104104907-104104929 CCACTCTCCTTAGGAGTAACTGG + Intergenic
1119630511 14:76227892-76227914 GCCCTCTGCCTGGGAGAGGCTGG - Intronic
1120253392 14:82088421-82088443 CCACTATGCCTGGCTGAGACTGG + Intergenic
1120476772 14:84998417-84998439 CCTATCTTCTGGGGAGAGACTGG + Intergenic
1122660774 14:103293571-103293593 CCCCTCTGTCTGGGAGACACAGG - Intergenic
1122993421 14:105249485-105249507 CCACTCTACTGGGGAGGGACGGG + Intronic
1125038536 15:35155678-35155700 ACACTCAGCTTGAGGGAGACTGG + Intergenic
1125205043 15:37144540-37144562 CCACTCAGCTTTGTAGAAACTGG + Intergenic
1126652530 15:50938766-50938788 CTACCCTGCCTGGGAGAGAGAGG - Intronic
1127043913 15:55006491-55006513 CCAGTCTGCAGGGGAGAGACTGG - Intergenic
1127542254 15:59952374-59952396 CCACTATGCCTAGTAGAGACGGG - Intergenic
1128183468 15:65624920-65624942 CCACTCTTCTGGGGGGAAACAGG - Exonic
1128558277 15:68646460-68646482 CCACTGTGGGTAGGAGAGACTGG - Intronic
1128731438 15:70024140-70024162 CCAGTCCCCTTGGGGGAGACAGG - Intergenic
1129035696 15:72647247-72647269 CTCCTCTGCTTGGGGGAGGCAGG + Intergenic
1129214188 15:74089969-74089991 CTCCTCTGCTTGGGGGAGGCAGG - Intergenic
1129355806 15:74990669-74990691 CCAGTCTGTTTGGGCGAGAAGGG + Intronic
1129379965 15:75158615-75158637 CCACTCTCCCTGGGAGGGTCAGG - Intergenic
1129399821 15:75275400-75275422 CTCCTCTGCTTGGGGGAGGCAGG + Intronic
1129473073 15:75765904-75765926 CTCCTCTGCTTGGGGGAGGCAGG - Intergenic
1129697604 15:77749512-77749534 CCACTCTGCTGGGGAGAGTCTGG - Intronic
1130817336 15:87451406-87451428 CAAATCAGCTTGAGAGAGACAGG + Intergenic
1131036485 15:89225895-89225917 CCACTGTGCTGGGCACAGACAGG - Intergenic
1131054099 15:89365473-89365495 ACACCCTGCTTGAGTGAGACCGG - Intergenic
1131199066 15:90381093-90381115 CCACTGTGCCTGGCTGAGACTGG + Intergenic
1131957124 15:97748537-97748559 TCTCTCTGCCTGGGAAAGACTGG + Intergenic
1132146991 15:99435031-99435053 CCACTTTGCTTGGGAGAAGGGGG - Intergenic
1133124205 16:3634513-3634535 CCACTGTGCCTGGCCGAGACAGG + Intronic
1133411110 16:5569684-5569706 CCACTCAGCTTGGTAGAGTGGGG + Intergenic
1133769067 16:8857185-8857207 CGACTATGCTTGTGGGAGACAGG - Intronic
1133904451 16:10008994-10009016 ACACTCTGATGGAGAGAGACAGG + Intronic
1134517663 16:14900150-14900172 CCACTCTGCTAGAAACAGACAGG + Intronic
1134705331 16:16298801-16298823 CCACTCTGCTAGAAACAGACAGG + Intergenic
1134962210 16:18413313-18413335 CCACTCTGCTAGAAACAGACAGG - Intergenic
1134966507 16:18495912-18495934 CCACTCTGCTAGAAACAGACAGG - Intronic
1135135563 16:19883974-19883996 CCCCTCTCCTTGGGGGACACAGG - Intronic
1135415354 16:22264636-22264658 CCCTTCTGCTTGGCAGAGAAGGG + Intronic
1140800470 16:78483283-78483305 TCACTTTACTTGGAAGAGACGGG + Intronic
1141077569 16:81021472-81021494 CCACTCTGCTGTGGAGTGACAGG - Intronic
1142245240 16:88967352-88967374 ACACACTGCCTGGGAGCGACGGG + Intronic
1142411248 16:89918269-89918291 CCACTCTGGCTGGGCGAGGCTGG + Exonic
1144879155 17:18422095-18422117 CTTCTCTCCCTGGGAGAGACAGG - Intergenic
1145081911 17:19901184-19901206 CCCCTCTGCTTGGGCAGGACTGG - Intergenic
1146575897 17:33991324-33991346 TCACCCTGCTGGGGAGAGCCAGG + Intronic
1147138432 17:38448162-38448184 CCTCCCTGCTTGGGAGGAACTGG + Intronic
1148581857 17:48749825-48749847 CCCCTCTGCTTGGGAGGAAGGGG - Intergenic
1149216128 17:54357048-54357070 CCATTCTGAATGGGAGAAACTGG + Intergenic
1150472817 17:65451641-65451663 ACATTCTACTTGGGAAAGACAGG + Intergenic
1151071074 17:71212194-71212216 CCTCTCTCATTGGGAGGGACAGG - Intergenic
1151401983 17:73861782-73861804 CCAATCTGCTTGAGAGTTACTGG + Intergenic
1152355782 17:79806537-79806559 CCCCTCAGCTTGGGACAGAGTGG - Intergenic
1153774795 18:8442999-8443021 CCTCTCTTCTTGGGGGAGAGGGG - Intergenic
1154388514 18:13916852-13916874 CCACTCTGATTGGGAGGGACAGG + Intergenic
1156495026 18:37520020-37520042 ACCCTCTCCTTGGGGGAGACTGG + Intronic
1158102288 18:53842743-53842765 CCACTAGCCTTGGGAGACACAGG + Intergenic
1158546617 18:58403232-58403254 CCACTCTGCCTGGAGGTGACGGG - Intergenic
1158631854 18:59122268-59122290 CCACTGTGCTCAGGAGACACTGG - Intergenic
1161576300 19:5056316-5056338 CCACTCTGCAGTGGAGACACTGG - Intronic
1162470165 19:10868313-10868335 TCACCCAGCTTGGGAGGGACAGG + Intronic
1162721184 19:12663896-12663918 CCCCTCTGCTTGGGAGGGGCAGG + Intronic
1164671472 19:30074485-30074507 CCACTGTGCTGAGGAGAGGCAGG - Intergenic
1165861827 19:38913070-38913092 CCACTATGCTTGGCTGAGAGTGG + Intergenic
1166118057 19:40667684-40667706 CCACTCTGCTTGGGAAAGCTGGG - Exonic
1167899890 19:52612123-52612145 CCACACTGCTTGGGAGACCGAGG - Intronic
1168357435 19:55710796-55710818 CCACCATGCCTGGCAGAGACTGG - Intronic
925294553 2:2768588-2768610 GAACCCTGCTTGGGACAGACGGG - Intergenic
925830989 2:7895356-7895378 CCACCCACCTTGGGCGAGACAGG + Intergenic
926754546 2:16224810-16224832 CCACTCTGGTTGTGTGAGCCTGG - Intergenic
927062833 2:19440573-19440595 CCAAACAGCTTGGTAGAGACTGG - Intergenic
927169143 2:20353776-20353798 CCACTCCGCTTGCTAGAAACTGG + Intergenic
928385003 2:30859657-30859679 CCACTCTGCTTTGAAGAGATAGG - Intergenic
929121770 2:38489519-38489541 ACTCTCAGCTTGGGAAAGACAGG - Intergenic
929868912 2:45741569-45741591 CCAATCTGATTGGTAGAAACTGG - Intronic
935481515 2:103595339-103595361 CCATTCTGAATGGGAGAAACTGG - Intergenic
935979687 2:108614317-108614339 CATCTCTGGTTGGCAGAGACTGG - Intronic
937115940 2:119405012-119405034 CAACTCTTCTTGAGTGAGACGGG - Intergenic
937244498 2:120483810-120483832 TCCCTCTCCTTGGGAGACACTGG + Intergenic
937295957 2:120810080-120810102 CTACTCTGCTGGGGGGAGCCAGG + Intronic
937892595 2:126950099-126950121 CCACTGTGCTTGGCCGAGACAGG - Intergenic
939765485 2:146243498-146243520 CCGCTCTTCTTGTGGGAGACGGG + Intergenic
942026084 2:171912321-171912343 CCACTGTGCATGGGAGCCACAGG + Intronic
942340183 2:174935547-174935569 ATAATCTGCTTGGGGGAGACAGG + Intronic
944661293 2:201923921-201923943 CCGCTCTGCTGGGCAGAGCCAGG - Intergenic
945256870 2:207810474-207810496 CCACTCTCCATGGGACAGAGAGG + Intergenic
948933546 2:241148467-241148489 TCACTCTGCTTGGTAGGGCCCGG - Intronic
1170092308 20:12604119-12604141 CTACTCTGCTTTTGAGAGGCAGG - Intergenic
1173187379 20:40850787-40850809 CCTCCCTCCTTGGGATAGACGGG + Intergenic
1174544746 20:51317005-51317027 GCATTCTGCCTGGGAGAGCCTGG - Intergenic
1174801867 20:53570854-53570876 CCGCTCTGCCTGTGAGAGGCAGG - Intronic
1175705642 20:61174594-61174616 CCAGTCAGCCTGGGAGAGGCAGG + Intergenic
1175819448 20:61900711-61900733 CCAAGCTGCATGGGAGAGATGGG + Intronic
1176195105 20:63833065-63833087 CCAGACATCTTGGGAGAGACTGG - Intergenic
1176258620 20:64167074-64167096 CCACTCTGCACTGGGGAGACAGG + Intronic
1177047144 21:16184556-16184578 TCGCTCTGCTTGGCAGAGACTGG + Intergenic
1179488432 21:41725777-41725799 CCACTCTGCAGGGGACAGAGTGG + Intergenic
1179501561 21:41812563-41812585 CGACTCTGATTGAGAGAGTCTGG + Intronic
1179985369 21:44918021-44918043 CCATTCTGCTTGGCACAAACTGG - Intronic
1180252420 21:46597991-46598013 CCACACTGCCTGGGACAGGCAGG + Intergenic
1183498466 22:38163801-38163823 CCACTCTGCTTGGTGAAGATGGG + Intronic
1184336892 22:43859106-43859128 TCACTGTGCCTGGGAGAGACAGG - Intronic
950545949 3:13637963-13637985 TCACACTGCGTGGGAGGGACTGG + Exonic
950571479 3:13802930-13802952 CCAGTCTGGTTGGGGGAGGCAGG + Intergenic
950872014 3:16237742-16237764 CCACTCTCCTTGGGAGGCCCTGG + Intergenic
951768096 3:26223209-26223231 CCACTCTACCTTGGAAAGACTGG + Intergenic
954702961 3:52461353-52461375 CCACTGAGCTTGGCAGGGACAGG + Intronic
954960746 3:54562711-54562733 CCACGCTGCTTGGCAGATACTGG - Intronic
955370265 3:58345155-58345177 CCCCTCTGCCTGGGAGAGCAGGG + Intronic
955419147 3:58719676-58719698 CCCCTTTTCTTGGGAGACACAGG - Intronic
955465779 3:59235915-59235937 CCACACTACTGGGGAGAGGCTGG - Intergenic
955826694 3:62954793-62954815 CCACTGTGATTGGCTGAGACTGG + Intergenic
957047788 3:75389873-75389895 GCACTCAGCTTGGGTGAGAAGGG - Intergenic
957885775 3:86285683-86285705 CAACTCTGCTTGGCTGAGGCAGG - Intergenic
961879866 3:130054005-130054027 GCACTCAGCTTGGGTGAGAGGGG - Intergenic
962279445 3:134039096-134039118 TGACGCTGCGTGGGAGAGACAGG - Intronic
964373362 3:156025016-156025038 CCAGTATGTTTGGAAGAGACAGG - Intergenic
965342193 3:167504085-167504107 CCCCTCTACTAGTGAGAGACAGG - Intronic
966303757 3:178507977-178507999 CCACTCTGCTTGAGTGTGAGAGG + Intronic
967557418 3:190876058-190876080 CCACTGTGCTTGGCTGACACTGG + Intronic
969945761 4:10781841-10781863 CCACTCTTCTTAAAAGAGACTGG - Intergenic
972624106 4:40779314-40779336 CCACAGTGCCTGGCAGAGACAGG - Intronic
973278832 4:48338453-48338475 ACACTCTACTGGTGAGAGACAGG + Intergenic
973830238 4:54752164-54752186 CCTCTCTGCTTGAGATAGAAAGG - Intergenic
974269002 4:59625865-59625887 CCACTCTGCTCGGAAAAGGCTGG + Intergenic
974487642 4:62525427-62525449 CAACTCTGAATGGGAGAAACTGG - Intergenic
976856089 4:89607249-89607271 CCTCTCTTCTTGGGGGAAACTGG + Intergenic
979571528 4:122232297-122232319 CAACTCTACTTGGGGGATACAGG - Intronic
980646191 4:135644707-135644729 CCACTCTACCTGGGAGAAATTGG - Intergenic
982122073 4:152152278-152152300 CCACTGTGTTTGGAAGAGGCAGG + Intergenic
983586471 4:169360854-169360876 CAATTCTGCTTTTGAGAGACTGG + Intergenic
984091357 4:175378950-175378972 CCATTCTGGTTGGGGAAGACTGG - Intergenic
984401890 4:179276582-179276604 TCACTCTTCTTGGGAGGGGCAGG - Intergenic
985374737 4:189323032-189323054 GCACTCTGCTTGACAGGGACAGG - Intergenic
985377482 4:189356149-189356171 CCACTGTGCTTGGGAGTGAGGGG + Intergenic
985664337 5:1174080-1174102 TCAGTCTGCTGGGGAGGGACTGG - Intergenic
986049892 5:4079714-4079736 TCACTCTGGTGGGGAGGGACTGG - Intergenic
987230991 5:15893167-15893189 CCTCTCAGCTGGGGAGAGGCAGG + Intronic
987391885 5:17384301-17384323 CCACTATGCAGGGGACAGACAGG + Intergenic
989428816 5:41327956-41327978 CCACTGTGCTTGGCAGATGCTGG + Intronic
992106725 5:73454253-73454275 TCTCTCTGCTTGGGAACGACAGG + Intergenic
997013940 5:129908121-129908143 CCTCTCTACCTGGGACAGACTGG + Exonic
999721023 5:154399353-154399375 CAACTCTGCCACGGAGAGACAGG - Intronic
1000225413 5:159256444-159256466 CCACCCTGGTTGGGAGGGAGAGG - Intergenic
1001397005 5:171424827-171424849 CCCCTCTGCTGGGGATAGGCTGG - Intronic
1002095848 5:176830248-176830270 CCACCCTGCTTGGGAGCTCCTGG - Intronic
1002129565 5:177071907-177071929 ACAGTAAGCTTGGGAGAGACAGG - Intronic
1002903112 6:1426511-1426533 CCACTCTCGGTGTGAGAGACTGG + Intergenic
1003696834 6:8415496-8415518 CCACTCTGCCTGGGACAGAAGGG - Intronic
1005260375 6:24052621-24052643 CCACTGGCCGTGGGAGAGACAGG - Intergenic
1005450292 6:25965508-25965530 CCACTCTGCCAGGGTGAGGCAGG + Intronic
1005451586 6:25978172-25978194 CCACTCAGCCTGGGAGACAGAGG - Intronic
1006190532 6:32205050-32205072 CCACTCAGCTAGTGAGAGAAGGG + Intronic
1007213717 6:40219491-40219513 GCTCTCTGCTTGGGAAAGAATGG + Intergenic
1007384379 6:41510726-41510748 CCACTCTGCTTGTGAGAGGCGGG - Intergenic
1007637684 6:43308947-43308969 CCACTCCACTTGGGAGACAAAGG + Intronic
1010470643 6:76223880-76223902 CCATCCTGCCTGTGAGAGACAGG + Intergenic
1013318057 6:108960251-108960273 AGACTGTGCTTGGCAGAGACTGG - Intronic
1013805104 6:113987855-113987877 CCACTCTGCTTGGAGATGACTGG - Intronic
1013821322 6:114156602-114156624 CAACTCTGCTTAGAAGAGGCTGG - Intronic
1015279583 6:131418913-131418935 CCACTGTGCCTGGCTGAGACTGG + Intergenic
1020314899 7:6898690-6898712 GCACTCAGCTTGGGTGAGAAGGG - Intergenic
1022657158 7:32330136-32330158 GCACTGTGCTTAGGACAGACTGG - Intergenic
1022946226 7:35287200-35287222 TCAGTCTGCTTGGGGGAGATAGG + Intergenic
1025129491 7:56368113-56368135 CCTCTCTGCGTGGGAGGGGCCGG + Intergenic
1025129539 7:56368291-56368313 CCTCTCTGCGTGGGAGGGGCCGG + Intergenic
1033582572 7:142750749-142750771 CCAGTCTGCCTGGGAGAGCTTGG + Intronic
1034543102 7:151772046-151772068 ACACTCTGGTGGGGAGAGACAGG + Intronic
1035095669 7:156352776-156352798 CCACCCTGGTTTAGAGAGACTGG - Intergenic
1035868719 8:3113210-3113232 CCTGTCTGCCTGGGAGACACTGG + Intronic
1036422947 8:8614762-8614784 TGACTCTGCTGGGAAGAGACCGG - Intergenic
1037044830 8:14285666-14285688 CCACTATTCTTGGGATAGTCAGG - Intronic
1037677034 8:21059740-21059762 AGACTCTTCTTGGGAGAGAAAGG - Intergenic
1037886418 8:22598675-22598697 CCACACTGCTAGGGAGCGCCGGG + Intronic
1038432982 8:27514756-27514778 TTCCTCTGCTTGGGAGACACTGG + Intronic
1038543845 8:28411041-28411063 CCACTATGCCTAGTAGAGACGGG - Intronic
1039887508 8:41663618-41663640 CCTCTGTGCTGGGGAGAGGCAGG - Intronic
1041371869 8:57170127-57170149 CCATTCACCTTGGGAGGGACTGG + Intergenic
1042151761 8:65794594-65794616 CTACACTGGTTTGGAGAGACAGG - Intronic
1044193979 8:89352899-89352921 CCATTCTGAATGGGAGAAACTGG + Intergenic
1044260528 8:90114714-90114736 CCACTCTGGTTGGGAGGGAAGGG + Intergenic
1046031575 8:108788537-108788559 CCACTCTGGTTGAAAGAGGCTGG - Intergenic
1046095831 8:109559338-109559360 CCTCGCTACTTGGGAGGGACTGG + Intronic
1046417640 8:113937803-113937825 CTACTCTCCTTTTGAGAGACAGG - Intergenic
1048250414 8:132862453-132862475 CCACCCTGCCTGGGAGGGTCAGG + Intergenic
1049025893 8:139988653-139988675 CCACGCTGCTTGGGAGGGTGTGG - Intronic
1051444508 9:17126046-17126068 CCACTCTGCTGTGGAGAGAATGG - Intergenic
1051504102 9:17808965-17808987 CCCATCTGCTTTGGAGATACTGG - Intergenic
1053507297 9:38654125-38654147 CCTCTCTGCTCGGGGGAGCCTGG + Intergenic
1056906190 9:90650198-90650220 GCACTCTGCTAGGGAGGGAATGG - Intergenic
1058777982 9:108304050-108304072 CCACTCTTCTAGGGTGAGAAAGG - Intergenic
1060197571 9:121633457-121633479 CCACCTTGCTTTGGAGACACAGG - Intronic
1060890808 9:127186919-127186941 CCAGTGGGTTTGGGAGAGACTGG + Intronic
1061272862 9:129553483-129553505 TCACCCTGCTTGGGAGAGGCAGG - Intergenic
1186393715 X:9186491-9186513 CCACACTGCGTGGAAGAGAGGGG + Intergenic
1186476853 X:9864326-9864348 CCTCTCTGATAGGGAGAGCCAGG + Intronic
1186508786 X:10115304-10115326 CCACACAGCTTGTGAGTGACTGG + Intronic
1189066173 X:37811599-37811621 CCACTGTGCTTGGCAGAGAGCGG + Exonic
1189597522 X:42585049-42585071 CCACCCTGGCTGGGAGAGGCAGG - Intergenic
1190580032 X:51883370-51883392 CCACTCTGCTTGGGAGAGACTGG - Intronic
1195369297 X:104157095-104157117 CCGGTCTGTTTGGGAGAGCCAGG + Intergenic
1195916621 X:109942413-109942435 CCACTCTGATATGGAGAGATCGG - Intergenic
1202098684 Y:21282002-21282024 GCACTCTGCTTGTGAGAAAAAGG + Intergenic