ID: 1190580861

View in Genome Browser
Species Human (GRCh38)
Location X:51892578-51892600
Sequence CGCCTGGATGGACCCACACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 1, 2: 0, 3: 7, 4: 104}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190580850_1190580861 21 Left 1190580850 X:51892534-51892556 CCTGATGTTCTGAGCACAGAGTG 0: 1
1: 0
2: 2
3: 12
4: 152
Right 1190580861 X:51892578-51892600 CGCCTGGATGGACCCACACAGGG 0: 1
1: 1
2: 0
3: 7
4: 104
1190580855_1190580861 -6 Left 1190580855 X:51892561-51892583 CCAAGGAGCAATTCCCACGCCTG 0: 1
1: 0
2: 2
3: 5
4: 104
Right 1190580861 X:51892578-51892600 CGCCTGGATGGACCCACACAGGG 0: 1
1: 1
2: 0
3: 7
4: 104
1190580854_1190580861 -5 Left 1190580854 X:51892560-51892582 CCCAAGGAGCAATTCCCACGCCT 0: 1
1: 0
2: 1
3: 6
4: 91
Right 1190580861 X:51892578-51892600 CGCCTGGATGGACCCACACAGGG 0: 1
1: 1
2: 0
3: 7
4: 104
1190580853_1190580861 -4 Left 1190580853 X:51892559-51892581 CCCCAAGGAGCAATTCCCACGCC 0: 1
1: 0
2: 0
3: 22
4: 88
Right 1190580861 X:51892578-51892600 CGCCTGGATGGACCCACACAGGG 0: 1
1: 1
2: 0
3: 7
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190580861 Original CRISPR CGCCTGGATGGACCCACACA GGG Intronic
900483006 1:2908431-2908453 TGCCTGGATGTGCTCACACACGG - Intergenic
900821430 1:4892344-4892366 CCCCAGGATGAACACACACAAGG + Intergenic
902796544 1:18804171-18804193 CGCCTCCATGGCCCCACGCAGGG + Intergenic
906288638 1:44604715-44604737 TGCCTGGATTGAGCCAGACATGG - Intronic
910318229 1:85913859-85913881 AGCCTGGATGGACTAAGACATGG - Intronic
914196432 1:145450394-145450416 CACCTGGCTGGACAGACACAGGG + Intergenic
914477704 1:148038046-148038068 CACCTTGATGGCGCCACACAGGG + Intergenic
918132586 1:181642784-181642806 AGCCTGGATGGCCCAGCACAGGG + Intronic
919766164 1:201128498-201128520 GTCCTGAATGGATCCACACAGGG - Intergenic
1064877494 10:20011307-20011329 CTGCTGGATGCACCCACAGAGGG + Intronic
1071789807 10:88941819-88941841 CGCCTGGATAGCCACATACATGG + Exonic
1072733973 10:97866925-97866947 GGTCAGGCTGGACCCACACAGGG - Exonic
1072921849 10:99583410-99583432 CACCTGCCTGGAGCCACACACGG + Intergenic
1074146520 10:110721515-110721537 TGCCTGGACAGACCCAAACATGG - Intronic
1074528046 10:114278410-114278432 CTCCTGGGTGGACCCTGACAAGG - Intronic
1076314558 10:129531439-129531461 CACCAGGAGGGACCCACAAAAGG - Intronic
1076381741 10:130028350-130028372 CGGCTGGCTGGACTCACCCAAGG - Intergenic
1081799314 11:45847260-45847282 CACCCGGGCGGACCCACACATGG + Intronic
1091127963 11:133118843-133118865 CTCCTGCACAGACCCACACATGG + Intronic
1094040703 12:26118542-26118564 CGCCTGGATGGCCAGAAACAGGG + Intergenic
1097199395 12:57265660-57265682 AGCCTGGATGGACCCAGATAGGG - Intronic
1102243780 12:111342121-111342143 GGCCTGGAGGGAGCCCCACATGG + Intronic
1104724286 12:131066498-131066520 CGGTGGGATGAACCCACACAAGG - Intronic
1112330281 13:98472066-98472088 CCACTGGAGGGACACACACAGGG + Intronic
1112672352 13:101654773-101654795 GGCCTGGATGCAACCACCCAGGG + Intronic
1113436882 13:110299385-110299407 GGGCTGGAAGGGCCCACACAAGG - Intronic
1114327323 14:21602332-21602354 GGCCTGGATAGACCCATGCATGG + Intergenic
1114330719 14:21634348-21634370 GGCCTGGATAGACCCATGCATGG + Exonic
1115295933 14:31826660-31826682 CGCATTGATGGATGCACACAAGG + Exonic
1123475797 15:20592090-20592112 GGCCTGGCGGGACCCACACCGGG - Intergenic
1123642213 15:22408273-22408295 GGCCTGGCGGGACCCACACCGGG + Intergenic
1131403065 15:92141946-92141968 GGGCTGGGTGGTCCCACACATGG - Intronic
1132798180 16:1736118-1736140 CACATGGATGGTCACACACACGG - Intronic
1132798328 16:1737612-1737634 CACATGGATGGTCACACACACGG - Intronic
1132798351 16:1737838-1737860 CACATGGATGGTCACACACACGG - Intronic
1132798358 16:1737910-1737932 CACATGGATGGTCACACACACGG - Intronic
1132798380 16:1738132-1738154 CACATGGATGGTCACACACACGG - Intronic
1132798416 16:1738498-1738520 CACATGGATGGTCACACACACGG - Intronic
1132798459 16:1738994-1739016 CACATGGATGGTCACACACACGG - Intronic
1133284104 16:4682703-4682725 CGCCTGCCAGGACCCACGCAAGG - Intronic
1134105903 16:11485920-11485942 GGGCTGGATGGACACACAGATGG + Intronic
1137644018 16:50058815-50058837 GGCATGGATGGCCACACACATGG + Intergenic
1151975302 17:77480861-77480883 GGCCTGGATGGGCCCAAGCAGGG + Intronic
1152689260 17:81710571-81710593 AGCCTGGATGGCCCCGGACAAGG + Intergenic
1152745340 17:82036233-82036255 CACCTGGAGTGACCCCCACAAGG - Exonic
1153822604 18:8845055-8845077 CACCTGGCCGGACACACACAAGG - Intergenic
1155178888 18:23325837-23325859 CTCCTGGCTGTACCCACACGGGG - Intronic
1156503515 18:37574829-37574851 GGCCTGGATTGACCCCCACGGGG - Intergenic
1158543796 18:58379045-58379067 CTCCTGGAGGACCCCACACAAGG - Intronic
1158797401 18:60863692-60863714 AGCCTGAATGGACCAAGACATGG + Intergenic
1158945279 18:62442401-62442423 GGCCTGGATGGCCACATACATGG - Intergenic
1160753741 19:747409-747431 CCACTGGTTGGGCCCACACAGGG - Exonic
1160986366 19:1840801-1840823 AGTCTAGATGGACCCAGACAGGG + Intronic
1163719600 19:18892747-18892769 TGCCTGCCTGGACCCACACAGGG + Intronic
1163828292 19:19535784-19535806 AGCTTGGATGGACCCACACTTGG + Exonic
1165161781 19:33820667-33820689 CCCGGGGATGGACCCACCCATGG - Intergenic
1167796566 19:51713414-51713436 CGCGTGGCTGGACTCACACCTGG + Exonic
925130381 2:1490011-1490033 CGCCACGAGGGTCCCACACAGGG + Intronic
925130391 2:1490061-1490083 CGCCACGAGGGTCCCACACAGGG + Intronic
925130401 2:1490111-1490133 CGCCACGAGGGTCCCACACAGGG + Intronic
925130421 2:1490211-1490233 CGCCACGAGGGTCCCACACAGGG + Intronic
925130440 2:1490311-1490333 CGCCACGAGGGTCCCACACAGGG + Intronic
925130460 2:1490411-1490433 CGCCACGAGGGTCCCACACAGGG + Intronic
925130470 2:1490461-1490483 CGCCACGAGGGTCCCACACAGGG + Intronic
928427869 2:31193470-31193492 CCCCACGATGGACCCTCACAGGG - Intronic
937474996 2:122207491-122207513 CGTCTGTATGGACCCACAAAAGG + Intergenic
938561059 2:132472295-132472317 GGCCTGGAGGGACCTACAGAAGG - Intronic
948693276 2:239720201-239720223 CACCTGGATGGACGGACACCTGG - Intergenic
948733378 2:239981255-239981277 CCCATGGATGGAGCCCCACAGGG + Intronic
1172014507 20:31864923-31864945 CCCCTGGATGGACCCATAGATGG - Intronic
1172657101 20:36543949-36543971 GGCCAGGAGGGACTCACACAGGG + Intronic
1173461555 20:43247172-43247194 TGCATGGATGGACGGACACATGG + Intergenic
1173673138 20:44811432-44811454 CGTCGGGATGCACCCACACTGGG - Intergenic
1173807830 20:45937521-45937543 CAGCCGGATGGACCCCCACAGGG - Exonic
1176000987 20:62831006-62831028 CGCCTGGCGGGACCTGCACACGG + Intronic
1178671756 21:34596840-34596862 CCCTTGGCTGGACCCACACTAGG + Intronic
1180088844 21:45523741-45523763 AGCCTGGCTGGGGCCACACAGGG + Intronic
1181646859 22:24236002-24236024 AGCCTGGATGGACTCACCCAGGG - Intronic
1183910396 22:41074827-41074849 GGCCTGGATGGCCACATACATGG + Intergenic
1184987160 22:48143785-48143807 CACCAGGATGGAGCCACATAAGG - Intergenic
950405783 3:12803671-12803693 CCCCAGGATGCTCCCACACAAGG - Intronic
951678727 3:25272433-25272455 CCTCTGGATGGACCCGGACATGG + Intronic
954746132 3:52788499-52788521 CTCCTGGCTGCACCTACACAGGG + Intronic
961344962 3:126258417-126258439 CTCCTGGATGGACCAGCAGAAGG - Intergenic
961530036 3:127535006-127535028 CTCCTGGAAGGAGCCACTCAGGG - Intergenic
967262483 3:187657133-187657155 CGGCTGCTTGGCCCCACACAGGG - Intergenic
977666832 4:99652852-99652874 CGCCCGGATGGCCCCGCACCTGG + Exonic
979452920 4:120893333-120893355 TGCCTTGATGGATCCCCACATGG + Intronic
981092424 4:140745399-140745421 TGCCTGGATCTACTCACACAGGG + Intronic
984683094 4:182633747-182633769 CGCCTGAAGGCACACACACAAGG + Intronic
987188671 5:15451077-15451099 GGCCTGGATGGCCACATACATGG - Intergenic
993014237 5:82517845-82517867 GGCATGGATGGAAACACACAAGG - Intergenic
1003306769 6:4936008-4936030 GGCCTGGGTGGACCCACACCCGG - Intronic
1003380650 6:5621738-5621760 TGCCAGGATAGACCCACTCATGG + Intronic
1006906450 6:37536624-37536646 CGCGCGCAGGGACCCACACAGGG + Intergenic
1014586566 6:123204419-123204441 AGCCTGAATGGACCAAGACAAGG + Intergenic
1017328882 6:153172558-153172580 TGCCTGGATGCAACCACACCCGG - Intergenic
1019611008 7:1936623-1936645 CGCACGGATGGACCTACCCACGG + Intronic
1024632971 7:51264284-51264306 AGCCAGGATGCAGCCACACAGGG + Intronic
1024633683 7:51269299-51269321 AGCCAGGATGCATCCACACAGGG + Intronic
1029149936 7:98472627-98472649 CCCCTGGATGGACCAACCAAGGG + Intergenic
1036637225 8:10559649-10559671 AGCCTGTGTGGATCCACACAAGG - Intergenic
1039290213 8:36086789-36086811 TGCCTGTATTTACCCACACATGG - Intergenic
1048503717 8:135001914-135001936 CCTTTGGATGGACACACACATGG + Intergenic
1052846821 9:33344169-33344191 CACCTGGATGGTCACACTCATGG - Exonic
1057189645 9:93079557-93079579 CGCCTGGCTGGGCCCGCTCACGG - Exonic
1062698300 9:137886441-137886463 CACCTGGCTGGACAGACACAGGG - Intronic
1186502963 X:10066663-10066685 CTCCTGGATGCACCTCCACATGG - Intronic
1186709805 X:12181743-12181765 CACTTGGAAGGACCCACACTCGG - Intronic
1190457927 X:50643558-50643580 AGCCTGGATGGACCTAGATATGG + Intronic
1190580861 X:51892578-51892600 CGCCTGGATGGACCCACACAGGG + Intronic
1190585128 X:51932362-51932384 TGCCTGGATGGACCCACACAGGG + Intergenic
1190720465 X:53143500-53143522 GGCCTGGATGGCCACATACATGG + Intergenic