ID: 1190598805

View in Genome Browser
Species Human (GRCh38)
Location X:52069300-52069322
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 366
Summary {0: 2, 1: 0, 2: 5, 3: 25, 4: 334}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190598805_1190598813 5 Left 1190598805 X:52069300-52069322 CCAACAAAAGCCCTTTCCTCCAG 0: 2
1: 0
2: 5
3: 25
4: 334
Right 1190598813 X:52069328-52069350 CAGTGCGCATGCGATTCCGCGGG 0: 2
1: 0
2: 1
3: 1
4: 20
1190598805_1190598814 8 Left 1190598805 X:52069300-52069322 CCAACAAAAGCCCTTTCCTCCAG 0: 2
1: 0
2: 5
3: 25
4: 334
Right 1190598814 X:52069331-52069353 TGCGCATGCGATTCCGCGGGTGG 0: 2
1: 0
2: 0
3: 1
4: 12
1190598805_1190598822 21 Left 1190598805 X:52069300-52069322 CCAACAAAAGCCCTTTCCTCCAG 0: 2
1: 0
2: 5
3: 25
4: 334
Right 1190598822 X:52069344-52069366 CCGCGGGTGGGTGGGCGGTGGGG 0: 2
1: 0
2: 3
3: 33
4: 523
1190598805_1190598818 16 Left 1190598805 X:52069300-52069322 CCAACAAAAGCCCTTTCCTCCAG 0: 2
1: 0
2: 5
3: 25
4: 334
Right 1190598818 X:52069339-52069361 CGATTCCGCGGGTGGGTGGGCGG 0: 2
1: 0
2: 0
3: 8
4: 132
1190598805_1190598819 19 Left 1190598805 X:52069300-52069322 CCAACAAAAGCCCTTTCCTCCAG 0: 2
1: 0
2: 5
3: 25
4: 334
Right 1190598819 X:52069342-52069364 TTCCGCGGGTGGGTGGGCGGTGG 0: 2
1: 0
2: 0
3: 18
4: 316
1190598805_1190598820 20 Left 1190598805 X:52069300-52069322 CCAACAAAAGCCCTTTCCTCCAG 0: 2
1: 0
2: 5
3: 25
4: 334
Right 1190598820 X:52069343-52069365 TCCGCGGGTGGGTGGGCGGTGGG 0: 2
1: 0
2: 0
3: 16
4: 275
1190598805_1190598817 13 Left 1190598805 X:52069300-52069322 CCAACAAAAGCCCTTTCCTCCAG 0: 2
1: 0
2: 5
3: 25
4: 334
Right 1190598817 X:52069336-52069358 ATGCGATTCCGCGGGTGGGTGGG 0: 2
1: 0
2: 0
3: 1
4: 23
1190598805_1190598815 9 Left 1190598805 X:52069300-52069322 CCAACAAAAGCCCTTTCCTCCAG 0: 2
1: 0
2: 5
3: 25
4: 334
Right 1190598815 X:52069332-52069354 GCGCATGCGATTCCGCGGGTGGG 0: 2
1: 0
2: 0
3: 0
4: 13
1190598805_1190598812 4 Left 1190598805 X:52069300-52069322 CCAACAAAAGCCCTTTCCTCCAG 0: 2
1: 0
2: 5
3: 25
4: 334
Right 1190598812 X:52069327-52069349 CCAGTGCGCATGCGATTCCGCGG 0: 2
1: 0
2: 0
3: 2
4: 25
1190598805_1190598823 28 Left 1190598805 X:52069300-52069322 CCAACAAAAGCCCTTTCCTCCAG 0: 2
1: 0
2: 5
3: 25
4: 334
Right 1190598823 X:52069351-52069373 TGGGTGGGCGGTGGGGTCGAAGG 0: 2
1: 0
2: 5
3: 62
4: 968
1190598805_1190598816 12 Left 1190598805 X:52069300-52069322 CCAACAAAAGCCCTTTCCTCCAG 0: 2
1: 0
2: 5
3: 25
4: 334
Right 1190598816 X:52069335-52069357 CATGCGATTCCGCGGGTGGGTGG 0: 2
1: 0
2: 0
3: 1
4: 35

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190598805 Original CRISPR CTGGAGGAAAGGGCTTTTGT TGG (reversed) Intergenic
901317905 1:8321527-8321549 GTGGAGGAAAGGGCCTTCCTGGG - Intronic
902704424 1:18194728-18194750 CAGGAGGACAGGGATGTTGTGGG + Intronic
902836536 1:19050805-19050827 GTGTAGGGAAAGGCTTTTGTTGG - Intergenic
903240668 1:21980792-21980814 CAGGAGGAAAGGGCCTCAGTGGG - Intronic
903244411 1:22005415-22005437 CAGGAGGAAAGGGCCTCAGTGGG - Intronic
903796824 1:25935417-25935439 TTGGAAGAAAGGGCATTTATAGG + Intergenic
905641852 1:39595444-39595466 TTGGAGGGCAGGGCTTGTGTGGG + Intergenic
905929623 1:41778027-41778049 CAGGAGGACAGGGATTTGGTTGG - Intronic
906055494 1:42913073-42913095 CTTTGGGAAAGGGCTATTGTAGG - Intergenic
906451636 1:45954304-45954326 CTGGAGGGAGGGGTTTTTGAAGG + Intronic
906834991 1:49073846-49073868 CTGGGGGAAAGGGCAGCTGTGGG - Intronic
906935269 1:50209097-50209119 GTGGAGGAAAGGGCATTTTAAGG - Intergenic
907855782 1:58302252-58302274 CTTGAGAAAAGGGATTTTCTTGG - Intronic
908611346 1:65864976-65864998 CTGGGGGAAGGGGCGGTTGTGGG - Intronic
908683233 1:66685470-66685492 CTGGAGGCAAAGAGTTTTGTTGG + Intronic
910387216 1:86698118-86698140 TTGGAGGAAAGGGTTGGTGTGGG - Intergenic
916212886 1:162372974-162372996 CTGGAGGAAAAGCCTTTGGGAGG + Intronic
916731549 1:167571511-167571533 CTGGAGGAAGGGGCGGCTGTGGG - Intergenic
917020683 1:170583051-170583073 ATGGAGGACAGGGGTTTTGGGGG - Intergenic
917216713 1:172686524-172686546 CTGGAGCATAGGCCATTTGTAGG + Intergenic
918526227 1:185467563-185467585 CTTGAGGATAGGGCCTTTGCTGG + Intergenic
919721616 1:200843052-200843074 CTGGAAGAAAGTTCTTTAGTGGG - Intronic
920637489 1:207718361-207718383 CTGGAGGATGGAGCTTGTGTGGG - Intronic
920857038 1:209671390-209671412 GTGGAGCAAAGGGCTATTGTGGG + Intergenic
921179241 1:212618769-212618791 CTAGGGGAAATAGCTTTTGTGGG + Intronic
923061191 1:230476225-230476247 CTGGGGGAAGGGGCATCTGTGGG - Intergenic
923879395 1:238086857-238086879 CAAAAGGAAAGGGCTTTAGTAGG + Intergenic
924510408 1:244725185-244725207 CTGAAGGAAGGGGCTTGTGGGGG - Intergenic
924898928 1:248373598-248373620 GTGGAGGGAAGGGGTTTTTTAGG + Intergenic
1063299161 10:4836315-4836337 CTGCAGTAAAGGGCTGTTTTTGG - Intronic
1063399095 10:5724066-5724088 CTCGAGGACAGAGTTTTTGTTGG + Intronic
1064478150 10:15713783-15713805 CTGGATGACAAGGTTTTTGTTGG - Intronic
1066604859 10:37154418-37154440 CAAGAGGAGAGGCCTTTTGTGGG + Intronic
1066606399 10:37178512-37178534 CAAGAGGAGAGGCCTTTTGTGGG + Intronic
1066607181 10:37190313-37190335 CAAGAGGAGAGGCCTTTTGTGGG + Intronic
1067087241 10:43249417-43249439 CTGGGGGAAGGGGGTTCTGTTGG + Intronic
1067145768 10:43692636-43692658 CAGCAGGGAAGGGCATTTGTCGG - Intergenic
1068254901 10:54497004-54497026 CTGGACCATAGTGCTTTTGTTGG + Intronic
1068460877 10:57326787-57326809 CTGGAGGAAAAGGCTCTGGTAGG + Intergenic
1068707112 10:60089217-60089239 ATGGAGGAAAGTACTTTTGGAGG - Intronic
1069798777 10:71069685-71069707 CTGGAGGACTGGGCTTCTGGGGG - Intergenic
1070480930 10:76882064-76882086 CTGGAGGAATGGGCTCTTGCAGG + Intronic
1070632541 10:78096918-78096940 CTGGGGGAAGGGGCGGTTGTGGG + Intergenic
1070999775 10:80818412-80818434 CTGGGGGAAGGGGCCGTTGTGGG + Intergenic
1071307783 10:84314329-84314351 ATGGAGGAAGGGGCTTTAGGGGG + Intergenic
1072057518 10:91774776-91774798 CCTGGGGAAAGGGCTTTTGCTGG - Intergenic
1072672958 10:97445108-97445130 ATTGAGGAAAGGAGTTTTGTGGG - Intronic
1073299403 10:102461692-102461714 CTGGAGGAAAGGGATGCAGTGGG + Intronic
1073889752 10:108086262-108086284 CTGAAGGAAAGGCCACTTGTGGG + Intergenic
1074157192 10:110809540-110809562 GTTTAGGAAAGGGCTTTGGTCGG + Intronic
1074304405 10:112263270-112263292 CTCGAGGGCAGGGCTTATGTGGG + Intergenic
1074985120 10:118651869-118651891 CTGGGGGAAAGGGCAGCTGTGGG - Intergenic
1076015462 10:127024124-127024146 CTGGAGGACTGGGCTTTTCTGGG + Intronic
1077336537 11:2007487-2007509 CTGTGGACAAGGGCTTTTGTGGG - Intergenic
1077519253 11:3022004-3022026 CTGAAGGATAGGGTGTTTGTGGG - Intronic
1078043694 11:7893478-7893500 CTGGAAGAGAGGGCTTTTGGGGG - Intergenic
1078779085 11:14420311-14420333 GTGGAGGAGAGGGAGTTTGTTGG - Intergenic
1079517919 11:21290037-21290059 CTGGGGGAAGGGGCATCTGTGGG + Intronic
1080596184 11:33775765-33775787 ATGGAGGAAATGGATTTTTTTGG - Intergenic
1080864090 11:36178222-36178244 TTGGAGGCAAGGGCTTCTGCAGG - Intronic
1082998719 11:59272941-59272963 CTGGAGGAAATGGGTTTTCTTGG - Intergenic
1083498450 11:63080395-63080417 CTGAAGGAAATGGATCTTGTTGG - Intronic
1083643190 11:64156692-64156714 CTGGAGAGAAGGGGCTTTGTGGG - Intronic
1085332573 11:75666444-75666466 CTGGAGAAAGGGGTTTTTGGTGG + Intronic
1085482657 11:76835713-76835735 CTGGAGGTCAAGGCTTCTGTGGG - Intergenic
1086425931 11:86682381-86682403 CTGGAGGTAGGGGATTCTGTAGG + Intergenic
1086981171 11:93198862-93198884 CTTTAGGAAAGGGTTTTTTTGGG + Intergenic
1090893619 11:130949773-130949795 CTGGAGGAAAGTGCTCCAGTGGG + Intergenic
1202819521 11_KI270721v1_random:62669-62691 CTGTGGACAAGGGCTTTTGTGGG - Intergenic
1092304419 12:7284099-7284121 CTGGGGGAAGGGGCGTCTGTGGG + Intergenic
1094447965 12:30552948-30552970 CTAGAAGACAGGGTTTTTGTAGG - Intergenic
1094656966 12:32429622-32429644 CTGGGGGAAAGGGCAGCTGTGGG - Intronic
1095623176 12:44282863-44282885 CAGGAGGAAAGTGGTTTCGTGGG + Intronic
1095694910 12:45133047-45133069 CTGGGGGAAGGGGCGGTTGTGGG + Intergenic
1098183133 12:67869467-67869489 CTGGGGGAAAGGGCAGCTGTGGG - Intergenic
1099327473 12:81237364-81237386 CAGGAGGCTAGGGCTTTTATAGG + Intronic
1099329290 12:81262047-81262069 ATGGAGAAAAGGGCTTTAGAGGG + Intronic
1099572197 12:84337078-84337100 CTGGGGGAAAGGTCTTATGTAGG - Intergenic
1100136326 12:91557327-91557349 CTGGGGGAAGGGGCGGTTGTGGG + Intergenic
1100768683 12:97897902-97897924 CTGGAGGAAGGGGCGGCTGTGGG - Intergenic
1100896313 12:99186283-99186305 CTGGAGGAAGGGGCAGCTGTGGG + Intronic
1101429777 12:104617218-104617240 CTGGAGTGAAGGGGATTTGTGGG + Intronic
1101946257 12:109139703-109139725 CTGGAAGAAAGGGGGTTTCTTGG - Exonic
1102199789 12:111049341-111049363 ATGGAGGAAGGGATTTTTGTTGG - Intronic
1103976283 12:124704908-124704930 CTGGGGGAAAGGGCTCTGGGGGG - Intergenic
1105538989 13:21298232-21298254 GTGGAGGAAAGGACTTCTGCGGG + Intergenic
1106381505 13:29244265-29244287 CTGGAGGAAATGGCCCTTTTAGG - Intronic
1106477778 13:30113170-30113192 CTGGAGTAAAAGGCTTACGTTGG - Intergenic
1106585938 13:31056122-31056144 TTGGAGGAAAGGGCTTTGGTGGG - Intergenic
1106608115 13:31250757-31250779 CTGGGGGAAGGGGCAGTTGTGGG + Intronic
1107968793 13:45621975-45621997 CTGGAGGAAGGGGCGGCTGTGGG - Intergenic
1108628715 13:52258631-52258653 CTCGTGGAAATGGCTTATGTTGG - Intergenic
1108657341 13:52547820-52547842 CTCGTGGAAATGGCTTATGTTGG + Intergenic
1109210563 13:59530662-59530684 GTGCAGGAAAGGCCTGTTGTAGG + Intergenic
1110254430 13:73417153-73417175 GTGGAGGAAATGGTTGTTGTTGG + Intergenic
1112146849 13:96709503-96709525 TTGGAGGTGAGGGCTTTTGGAGG + Intronic
1112376198 13:98843696-98843718 CAGGAGGACAGGGCTCTTGTGGG + Intronic
1113150202 13:107254677-107254699 CTGAAGGAAAAGTCTTGTGTAGG - Intronic
1113650882 13:112033473-112033495 CTGGCAGACAGGGCTTTGGTGGG + Intergenic
1114376697 14:22154038-22154060 TTGGGGGAAGGGGCTTTTCTGGG + Intergenic
1115048650 14:29028977-29028999 CTGGGGGAAGGGGCTGCTGTGGG - Intergenic
1118960315 14:70524156-70524178 CTGAAGCAAAGTTCTTTTGTGGG - Exonic
1119380403 14:74224652-74224674 CTGGAGGGAAGGACTGTGGTAGG - Intergenic
1119401195 14:74363838-74363860 CTGGAGGAAGAGGATTTTGGTGG + Intergenic
1119774856 14:77242132-77242154 CTGGAGGAAAGGGCATTTGAGGG - Intronic
1120130051 14:80795982-80796004 ATTGAGGAAAGTGCTTTTGTTGG - Intronic
1120298600 14:82677215-82677237 CTGAATGAAAAGGCTTTTATGGG - Intergenic
1121695038 14:95905284-95905306 CTGGATGGAAGGACATTTGTGGG - Intergenic
1121878983 14:97482455-97482477 CTGGAGGAAAGAGCCTATGAAGG + Intergenic
1122422790 14:101588016-101588038 CTAGAGACAGGGGCTTTTGTTGG - Intergenic
1123963911 15:25437790-25437812 TTGGTGGTAAAGGCTTTTGTTGG - Intronic
1125379391 15:39071094-39071116 AGGGAGGTAAGGGCTTGTGTAGG - Intergenic
1127327773 15:57912185-57912207 CAGGAGGAAAAGGCTTATCTGGG - Intergenic
1127435279 15:58951268-58951290 CTGGACGGAAGGGCTTGTCTAGG + Intronic
1131034039 15:89209616-89209638 CTGGAGGAGACAGCTTTTGGTGG + Intergenic
1132677807 16:1127836-1127858 CTGGAGGGAGGGGCTTCTGGAGG - Intergenic
1132986415 16:2769839-2769861 CTGGAGCACAGGGCATGTGTGGG - Intronic
1133433343 16:5757641-5757663 CAGGAGGAAATGAGTTTTGTTGG + Intergenic
1133613770 16:7456842-7456864 TTGGAGGAAAGGGCATATTTTGG + Intronic
1135149393 16:19992251-19992273 TTGGAGGTAAGGGCTTTGGGAGG + Intergenic
1136414574 16:30095701-30095723 CTGGAGGAAGGGGCTTTGGAGGG + Exonic
1137421606 16:48339687-48339709 AGTGAGGAAATGGCTTTTGTTGG + Intronic
1138179392 16:54931663-54931685 CTGGCGGGAAGGGGTTCTGTGGG + Intronic
1138380826 16:56601180-56601202 TTGGAGGAGAGGGCATTTGGGGG + Intergenic
1142292228 16:89198452-89198474 CTGGAGAAACGGGCTTATCTTGG - Exonic
1143476802 17:7207904-7207926 CTGGGGGAGGGGGCGTTTGTGGG - Intronic
1144471439 17:15545582-15545604 CTGGTGGGAAGGGGTTTTTTAGG + Intronic
1144925035 17:18799124-18799146 CTGGTGGGAAGGGGTTTTTTAGG - Intronic
1146605210 17:34252043-34252065 CTGGAGGAGAGGCCTTGAGTGGG + Intergenic
1147550586 17:41438890-41438912 CATGAGGAAAGGGCCTTTGATGG + Intronic
1147555540 17:41476739-41476761 ATGCAGTAGAGGGCTTTTGTTGG - Exonic
1148754732 17:49967128-49967150 CGGGAAGAAGGGGCTTTTGCAGG - Intergenic
1148970220 17:51473553-51473575 CATGAGGAGAAGGCTTTTGTAGG + Intergenic
1150314669 17:64158442-64158464 CTGCAGGAAAGGGCTGCTGCTGG + Intronic
1151023358 17:70646214-70646236 CTGGAAGAAAGTTATTTTGTAGG - Intergenic
1151658577 17:75507134-75507156 CAGGAGGAAAGGGTTTCTGAGGG + Intronic
1152721231 17:81924731-81924753 GTGTAGGAAAGGGCTCCTGTGGG - Intronic
1153469596 18:5429114-5429136 GTGGAGGGAAGGGCGGTTGTTGG - Intronic
1153743228 18:8151225-8151247 CTGGGGGAAAGGGCAGCTGTGGG - Intronic
1154388403 18:13916195-13916217 CTGCAGGGAAGGGCTACTGTTGG + Intergenic
1155006737 18:21735921-21735943 CTGGGGGAAGGGGCAGTTGTGGG + Intronic
1156471116 18:37377822-37377844 CTGGAGGAAAGTGGGTTTCTGGG + Intronic
1156979228 18:43265400-43265422 CTGGGGGAAAGGGCTGTTGTGGG - Intergenic
1157565829 18:48678623-48678645 CTGGAGGTGAAGACTTTTGTTGG + Intronic
1157797104 18:50584954-50584976 CTGAAGGAAATGGCTTTGTTTGG + Intronic
1158530803 18:58258623-58258645 CTGGAATAAAGAGCTTTTCTTGG + Intronic
1159562245 18:70007802-70007824 CTGGGGGAAAGGGCGGCTGTGGG + Intronic
1159995837 18:74963016-74963038 CTGGAAGAAGGGGCTGATGTGGG - Intronic
1160756794 19:761732-761754 CTGGAGGAAGGGGCTTCCGTTGG - Intronic
1161204642 19:3034623-3034645 CTGGGGGAGAAGGCTTTTGCAGG - Intronic
1162678822 19:12322650-12322672 CAGGAGGAATGGGCTTTGCTGGG - Exonic
1165455278 19:35907265-35907287 CTGGAGGTGAGGGGTGTTGTGGG + Intronic
1165991868 19:39819928-39819950 CAGGAGGACAGGGCTTTCGGGGG + Intergenic
1166165126 19:40982288-40982310 CTGGAGAAAAGGGATTCTGCAGG - Intergenic
1166874222 19:45887248-45887270 CTAGAGAAAGGGGCTGTTGTGGG - Intergenic
1167117433 19:47496498-47496520 CAGGAGGACAGGGGTGTTGTGGG + Intronic
1168430052 19:56271558-56271580 CTGGAGGAGAGAGTTCTTGTTGG - Intronic
925206843 2:2014352-2014374 CTGGAGCACAGGGCTGCTGTGGG - Intronic
925252406 2:2451288-2451310 CTGGGGGAAGGGGCTGTTGTGGG - Intergenic
925330110 2:3052110-3052132 CTGGAGGAGAGGGCTTTCTCCGG - Intergenic
926245985 2:11122801-11122823 CTGGAGCACAGGGCATGTGTGGG - Intergenic
926350204 2:11987225-11987247 CTGGAGGGATTGGCTCTTGTAGG + Intergenic
926483404 2:13427403-13427425 CTGGGGGAAAGGGCAGCTGTGGG - Intergenic
926787274 2:16530673-16530695 GGGAAGGAAAGGGCTTTGGTTGG + Intergenic
930264677 2:49186092-49186114 CTGGGGGAAGGGGCGGTTGTGGG - Intergenic
932959361 2:76394835-76394857 CTGGAGGGCAAGGTTTTTGTAGG - Intergenic
933047454 2:77557231-77557253 CAAGAGGATAGGGCTTTTGCAGG - Intronic
933352966 2:81178678-81178700 CTTGAGGATAGGGCCTTTGCGGG + Intergenic
937152233 2:119693721-119693743 CTGAAGCAAAGGGCTCCTGTGGG + Intergenic
939359299 2:141148410-141148432 CAGGAGGAAAGACGTTTTGTTGG + Intronic
939776885 2:146398933-146398955 CTTGAAGACAGGGCTTGTGTAGG + Intergenic
939801209 2:146711715-146711737 CAAGAGGAAAGGGCCTTTATGGG - Intergenic
939946972 2:148421977-148421999 CTGGGGGAAGGGGCAGTTGTGGG + Intronic
940593956 2:155766690-155766712 CTGGGGGAAGGGGCTGCTGTGGG - Intergenic
940602651 2:155880754-155880776 CTGGGGGAAAGGGAGTCTGTGGG + Intergenic
940787374 2:157996206-157996228 CTGGAGAGAAGAGCTTTTCTTGG + Intronic
942591458 2:177551803-177551825 CTGGAGGAAAGGGATTCTGTTGG + Exonic
942598582 2:177617741-177617763 CTGGAGGAAAGGGATTCTGTTGG + Exonic
943333022 2:186583396-186583418 TTGTAGGAAAGTTCTTTTGTGGG - Intergenic
943454830 2:188092688-188092710 CTGGAGAAAGGGGATTTGGTTGG - Intergenic
943552437 2:189357329-189357351 CTGGGGGAAGGGGCATCTGTGGG - Intergenic
943741733 2:191417466-191417488 CTGGGAGAATGGGCTTTGGTGGG + Intronic
945207279 2:207345002-207345024 CTGGGGGAAAGGGCGGCTGTGGG + Intergenic
946239796 2:218346534-218346556 CTGGAGGAGGGGGCCTTTGAGGG - Exonic
946823610 2:223654775-223654797 CTGGAGGAAAGGCAGATTGTTGG - Intergenic
947357919 2:229316205-229316227 CTGGAGGTTGAGGCTTTTGTGGG - Intergenic
947869241 2:233423775-233423797 CTGGAAGAGCAGGCTTTTGTTGG + Intronic
948027010 2:234786355-234786377 CTGGAGGAAATGTCTTTCTTTGG - Intergenic
948219716 2:236259928-236259950 ATGGTGGAAAGGGCTTTTTCTGG - Intronic
948708353 2:239809729-239809751 CGGACGGAAATGGCTTTTGTTGG - Intergenic
1169176687 20:3522460-3522482 CTGGGGGAATGGGCATCTGTGGG + Intronic
1169649204 20:7848062-7848084 CTGGAGCAAAGGGTTGTCGTTGG + Intergenic
1173362840 20:42359918-42359940 ATGGATCAAAGGGCTGTTGTAGG + Intronic
1175658317 20:60791281-60791303 CAGCAGGAAAGGGCTTTACTGGG - Intergenic
1175698619 20:61121450-61121472 CTGGAGGAAAGTGCTTTCTGGGG - Intergenic
1176678235 21:9801067-9801089 GTGTAGGAAAGGGATGTTGTAGG + Intergenic
1176678266 21:9801226-9801248 GTGTAGGAAAGGGGTGTTGTAGG + Intergenic
1176678279 21:9801290-9801312 GTGTAGGAAAGGGGTTGTGTAGG + Intergenic
1176913288 21:14594706-14594728 CTGCAGCAAAGGGCATTTGATGG + Intronic
1177899228 21:26893499-26893521 CTGGATGCAAAGGCTATTGTAGG + Intergenic
1178130677 21:29569492-29569514 CTACAGGAAAGTGTTTTTGTTGG - Intronic
1180202079 21:46229937-46229959 CTGGATGTCAGGGCTTCTGTGGG - Intergenic
1181583741 22:23841913-23841935 CTGGAGGGAAGTGCATTTGCTGG + Intergenic
1182686742 22:32126580-32126602 ATGAAGGAAAGAGATTTTGTGGG + Intergenic
1183309308 22:37100902-37100924 AGGGAGGAAAGGGCTTCTGGAGG + Intronic
1184295746 22:43523440-43523462 TTGGAGGAAAGGTCTTTTGGAGG + Intergenic
1184652505 22:45925639-45925661 GTGGAGGGAAGGGCTTTTCCAGG - Intronic
1185091513 22:48778318-48778340 CTTCAGGAAAGGGCTTGTTTGGG - Intronic
949180046 3:1118005-1118027 CTTGAGGCAAGGGCTTATTTGGG - Intronic
949377713 3:3408115-3408137 CTGGGGGAAAGGGCGGCTGTGGG + Intergenic
949925036 3:9034197-9034219 CTGGGGCAAAGGCCTTTTGAAGG + Intronic
950028236 3:9835027-9835049 GTGGAGGAAGGGGCTTCTGAGGG - Exonic
950072508 3:10164250-10164272 ATGAAAGCAAGGGCTTTTGTAGG + Intergenic
950509796 3:13419547-13419569 CTGGAGGAAAGGAGTTTTGGAGG - Intronic
950957224 3:17067030-17067052 GTGGAGGGAAGTGCTTTTTTTGG - Intronic
951183128 3:19682278-19682300 CTGGGGGAAGGGGCTGCTGTGGG - Intergenic
951237666 3:20254281-20254303 CTGGAGGAAGGGGCAGTTGTGGG - Intergenic
952324682 3:32310288-32310310 CTAGAGCAAAGGGATTTTGCTGG + Intronic
952541243 3:34370519-34370541 GAGGAGGAAAGTGGTTTTGTGGG + Intergenic
954656438 3:52197168-52197190 CTTGAGGAAAGGGCCTTTGAGGG - Intergenic
956137716 3:66115482-66115504 CTGGAGTACTGGGGTTTTGTTGG + Intergenic
960690005 3:120336383-120336405 TTGGAGGAGAGGGCTTGTGAAGG + Intronic
961049259 3:123733185-123733207 CTGGAGGAAAGGGCTCAGTTTGG + Intronic
961671636 3:128536325-128536347 GATGAGGAAAGGGCTTTTCTCGG - Intergenic
962745921 3:138397078-138397100 CTGGAGGAGAAGGGTTTGGTGGG + Intronic
963471759 3:145750096-145750118 CTGGACAAAAGGTTTTTTGTTGG - Intergenic
964096294 3:152935400-152935422 CTGGAGGCATGTACTTTTGTGGG - Intergenic
965684972 3:171293002-171293024 CTGGAAAAAAGGACTTTAGTGGG - Intronic
965801252 3:172496508-172496530 CTGGAGGAAAGGACTGCTGTGGG - Intergenic
966316751 3:178655993-178656015 AAGGAGAAAAGGCCTTTTGTGGG - Intronic
967085280 3:186089469-186089491 TTTGAGGAGAGGGCTTTTGGGGG - Intronic
967638661 3:191834993-191835015 CTGGGGGAAGGGGCAGTTGTGGG + Intergenic
967666854 3:192182858-192182880 ATGCAGTAAAGGGCTTTTATTGG + Intronic
967715641 3:192758588-192758610 CTGGAGGAAGGGGCAGCTGTGGG + Intronic
967838444 3:193984065-193984087 CTGGAGGAGAAGCCTTCTGTTGG - Intergenic
967859811 3:194141937-194141959 CTGGTGGCAAGGTCTTTTTTGGG - Intergenic
970376309 4:15460787-15460809 CATGAGGAAAGGGAGTTTGTGGG + Intergenic
971623123 4:28882854-28882876 CTGGAGGAAGAGTCTTTTCTTGG - Intergenic
974280071 4:59780679-59780701 CTGGGGGAAAGGGCAGCTGTGGG + Intergenic
974752267 4:66156291-66156313 CTTGAGGACAGGGCCTCTGTTGG - Intergenic
975598861 4:76078454-76078476 GTGGAGGAAAGTGCATTTCTTGG + Intronic
977671444 4:99699615-99699637 CTGGGGGAAAGGGCGGCTGTGGG + Intergenic
979147471 4:117263115-117263137 ATGGAGGAAAGGACCTCTGTGGG + Intergenic
979422808 4:120527160-120527182 GTGGAGCAAGGGGCTTTTATAGG + Intergenic
980157587 4:129126116-129126138 CTAGAGGAAGGGGCCCTTGTGGG - Intergenic
980248000 4:130272285-130272307 CAGAAAGAACGGGCTTTTGTTGG + Intergenic
980406340 4:132357414-132357436 ATGGAGCAGAGGGCTTTAGTTGG + Intergenic
980938851 4:139253409-139253431 CTGAAGGAAAGGGTGTGTGTAGG - Intergenic
981202128 4:141992607-141992629 CTGGGGGAAAGGGTGGTTGTGGG - Intergenic
981447952 4:144862178-144862200 CTGGAGAAAAGGCCTATTGCTGG + Intergenic
982168433 4:152637754-152637776 CAGGTGGAAAGTGCATTTGTGGG - Intronic
983028958 4:162773938-162773960 CTTGAGGAATGGGCATTTTTGGG - Intergenic
983602683 4:169548562-169548584 CTGGGGGAAGGGGCAGTTGTGGG - Intronic
983899792 4:173121845-173121867 CTGGAACTAAGGGCTTTTCTGGG + Intergenic
987473001 5:18355584-18355606 CTGAAGGAAATGGCTTTTCACGG - Intergenic
987656582 5:20815174-20815196 CTGGGGGAAGGGGCTGCTGTGGG + Intergenic
988021501 5:25627472-25627494 CTGGGGGAAGGGGCAGTTGTGGG + Intergenic
988664150 5:33306899-33306921 CTGGAAGAGAGGGCTATTCTTGG - Intergenic
988766971 5:34388771-34388793 CTGGGGGAAGGGGCTGCTGTGGG - Intergenic
988927083 5:36000575-36000597 CTGGAGGTAAAGGTCTTTGTTGG - Intergenic
989618994 5:43366741-43366763 CTGGGGGAAGGGGCTGCTGTGGG - Intergenic
990787343 5:59437043-59437065 CAGTAGCTAAGGGCTTTTGTTGG - Intronic
991396078 5:66206657-66206679 GAGGAGGAAAAGGATTTTGTTGG + Intergenic
992472671 5:77074127-77074149 CTGCAGGATAGGGCATATGTAGG + Exonic
992903697 5:81324363-81324385 CTGAAGGAAAGGGAATTTGTTGG + Intergenic
993510717 5:88768382-88768404 CTGGAGGCAAAGGCTGTAGTAGG + Intronic
993552189 5:89287184-89287206 CTGTATGAAAGGGGTTTTGATGG + Intergenic
993900190 5:93579677-93579699 ACGGAGGAAAGCGCTCTTGTTGG + Intergenic
995940355 5:117574963-117574985 CTGGAGTGAAGGGCTGCTGTAGG - Intergenic
999361914 5:150992633-150992655 CTGAAGGAAGGGGCATTTTTGGG + Intergenic
999948035 5:156618741-156618763 CAGAAGGAAAAGGCATTTGTTGG + Intronic
1000136045 5:158351991-158352013 CTTGAGGAAAGAGGTTGTGTTGG - Intergenic
1001145833 5:169183640-169183662 TTGAAGGTAAGGGCTTTTGCTGG - Intronic
1001148155 5:169202971-169202993 CTGGATGCAGGGGCATTTGTGGG - Intronic
1001671208 5:173475471-173475493 CAGGAGGAGAGGGATTTGGTGGG - Intergenic
1001937839 5:175718429-175718451 GGGGAGAAAAGGGCTTTTCTGGG - Intergenic
1002697354 5:181099800-181099822 CTGGGGCAAAGGGCTCATGTTGG + Intergenic
1002719269 5:181247807-181247829 CTGGAGAAAAGGGCTCTGGCAGG - Intronic
1003206379 6:4016523-4016545 ATGCAGGAAAGGGAGTTTGTAGG - Intergenic
1003646035 6:7913412-7913434 CTGGAGGACTGGGCTTTGCTAGG - Intronic
1004093428 6:12528870-12528892 TTGGAGGAAATTGCTTTTGTGGG - Intergenic
1005943538 6:30579272-30579294 CTGGAGGGTAGGGTTTTTCTGGG + Intronic
1006187188 6:32188211-32188233 GTGGAGGGAAGGGCTCTTGCAGG - Intronic
1006300052 6:33189233-33189255 CAGGAGGAAAGGGGTTGTGGCGG - Intronic
1007934156 6:45718434-45718456 GGGGAGCACAGGGCTTTTGTTGG + Intergenic
1007947392 6:45838561-45838583 CTGGAGGAGGGGGCATTTGGAGG - Intergenic
1007991730 6:46262859-46262881 CTGGAGGAAAAGGCTGTTACTGG - Intronic
1008176167 6:48270643-48270665 CTGGAGGAAGGGGCAGCTGTGGG - Intergenic
1012231479 6:96765430-96765452 ATTGAGGACAGGGGTTTTGTTGG + Intergenic
1014278898 6:119418505-119418527 CTGGGGGAAGGGGCAGTTGTGGG + Intergenic
1014696103 6:124623000-124623022 CTTGAGGATGGGGCTTTTGCCGG + Intronic
1017966701 6:159273008-159273030 CTGGAGGCAATTGCTTTTCTGGG + Intergenic
1018094469 6:160373602-160373624 CTGGAGGAAGGGGCAGCTGTGGG - Intronic
1020148737 7:5665338-5665360 CCTGAGGAAAGGGCTTCTTTGGG + Intronic
1021392609 7:20112340-20112362 GTAAAGGAAAGGGCTTTTCTAGG - Intergenic
1021805686 7:24352683-24352705 CTGGGGGAAGGGGCGGTTGTGGG + Intergenic
1022264536 7:28741281-28741303 ATGGAATAAAAGGCTTTTGTGGG - Intronic
1022505121 7:30904935-30904957 CTGGAGGAAAGGGCCCATGAAGG - Intergenic
1022540931 7:31134880-31134902 GTGGAAGAAAGGGAGTTTGTGGG + Intergenic
1026239187 7:68557158-68557180 TTGCAGTAAAGGTCTTTTGTGGG + Intergenic
1028385713 7:90250809-90250831 CTGGAGGAAGAGGTTTGTGTTGG - Intronic
1029065849 7:97847498-97847520 CTAAGGGAAAGGGCTTTTATTGG - Intergenic
1029798193 7:102917609-102917631 CTGGAGTTAAGGGCTTCTCTTGG + Intronic
1030386499 7:108873928-108873950 CTTGAGGGTAGGGCCTTTGTGGG - Intergenic
1030661476 7:112223671-112223693 CTGGACAAAAGCGCCTTTGTGGG - Intronic
1031122799 7:117740659-117740681 ATGGAGGAAAGGGGTTTTCTAGG - Intronic
1033074841 7:138239263-138239285 CTGGAGGCTAGGGGTTTTATGGG + Intergenic
1033391540 7:140933218-140933240 CAGGAGGTAAGGGCTTTGGGAGG - Intergenic
1033888224 7:145974941-145974963 CAGGAGGTAATGGCATTTGTTGG - Intergenic
1034218967 7:149429950-149429972 CTGGATGAAAGGGCCTGTCTAGG - Intergenic
1036290021 8:7479332-7479354 CACGAGGAAAAGGCTTTTATAGG + Intergenic
1036331455 8:7832191-7832213 CACGAGGAAAAGGCTTTTATAGG - Intergenic
1038842783 8:31201550-31201572 CAGGAGGAAAAGGCTTTTCTTGG - Intergenic
1038998350 8:32951260-32951282 CTTGAGGAAAGAACTTTAGTGGG + Intergenic
1040779953 8:51095515-51095537 CTGGGGGAAAGGGCGGTTGTGGG + Intergenic
1042348579 8:67752082-67752104 CTTGAGGATAGGGCCTTTGCTGG + Intergenic
1044712120 8:95068067-95068089 CTAGAGAAACAGGCTTTTGTTGG + Intronic
1045322408 8:101092012-101092034 CGGGAGGAAAGGACTTTGGCTGG - Intergenic
1045776837 8:105814321-105814343 TTGGAGGAAAGCTCTTTTGTTGG + Intergenic
1046326526 8:112654290-112654312 ATGAATGAAAAGGCTTTTGTTGG + Intronic
1046349601 8:112990007-112990029 CAGGAGGCAAGAGCTTGTGTAGG - Intronic
1047277347 8:123416422-123416444 CTGGAGGACCGGGCTCTGGTGGG - Intergenic
1048225075 8:132577314-132577336 CTGGAAGAAGGTGTTTTTGTAGG - Intronic
1048531363 8:135253301-135253323 CTTGAGGGAGGGGCCTTTGTTGG - Intergenic
1049542783 8:143215960-143215982 CTGGAGGGAAGGGGATTTGGAGG + Intergenic
1051353973 9:16223923-16223945 CTGGGGGAAGGGGCGGTTGTAGG + Intronic
1051674529 9:19546285-19546307 CTGGCGGAAGGGGCGGTTGTAGG - Intronic
1052144000 9:25025479-25025501 CTGGGGGAAGGGGCATCTGTGGG - Intergenic
1053050878 9:34959252-34959274 CTGGAGGGAAAGGCCTTTGAAGG + Intronic
1054867068 9:70013554-70013576 CAGGAAGAAAGGGCTTTGGAAGG + Intergenic
1055125660 9:72716356-72716378 CTGGGGGAAGGGGAGTTTGTGGG - Intronic
1055341570 9:75289913-75289935 CTGTAGGAAACTGCTTTTGCTGG + Intergenic
1055799133 9:80013421-80013443 ATGGAGGAAAGGATTTTTGGAGG + Intergenic
1056003475 9:82242595-82242617 CTAGGGGAAGGGGCGTTTGTGGG - Intergenic
1059501370 9:114756853-114756875 CTGGAAGAAGGGGCTTTTGCAGG + Intergenic
1060672981 9:125486679-125486701 CTGAAGGAAAGTACTATTGTGGG - Intronic
1060770946 9:126331842-126331864 CTGAAGGAAGGGGCGTTGGTTGG + Intronic
1061730687 9:132611569-132611591 TGGGAGGAAAGGGCTCTTTTTGG + Intronic
1062263759 9:135677158-135677180 CTACAGGACAGGGCTTTCGTGGG + Intergenic
1062319585 9:135984234-135984256 CTGGAGGAGAGGGCTCTGCTGGG + Intergenic
1203663401 Un_KI270754v1:3606-3628 GTGTAGGAAAGGGATGTTGTAGG + Intergenic
1203663432 Un_KI270754v1:3765-3787 GTGTAGGAAAGGGGTGTTGTAGG + Intergenic
1203663445 Un_KI270754v1:3829-3851 GTGTAGGAAAGGGGTTGTGTAGG + Intergenic
1187848616 X:23567251-23567273 TTGGAAGTGAGGGCTTTTGTGGG + Intergenic
1188400427 X:29737308-29737330 CTAGAGGATAGAGCTTTTGGAGG + Intronic
1190598805 X:52069300-52069322 CTGGAGGAAAGGGCTTTTGTTGG - Intergenic
1190610019 X:52184773-52184795 CTGGAGGAAAGGGCTTTTGTTGG + Intergenic
1191793833 X:64999986-65000008 CTGGGGGAAGGGGCGGTTGTGGG + Intronic
1191848543 X:65568914-65568936 CTGGGGGAAGGGGCTGCTGTGGG - Intergenic
1191984892 X:66969019-66969041 CTGGAGGAAGGGGCAGCTGTGGG + Intergenic
1192403749 X:70863100-70863122 CTGGGGGAAGGGGCGTCTGTGGG + Intronic
1192657995 X:73012492-73012514 ATGGAGGAAAAGGTATTTGTTGG + Intergenic
1193294749 X:79821196-79821218 CTGGAGGTGAGGGTCTTTGTTGG + Intergenic
1193389219 X:80906651-80906673 CTGGGGGAAGGGGCGGTTGTGGG + Intergenic
1193394525 X:80968148-80968170 CTGGGGGAAGGGGCGCTTGTGGG + Intergenic
1193595049 X:83435594-83435616 CTGGGGGAAAGGGCGGCTGTGGG - Intergenic
1193683790 X:84553106-84553128 CAGAAGGAAGGGGCTTTTTTTGG + Intergenic
1193774261 X:85622974-85622996 CTGGGGGAAGGGGCGGTTGTCGG + Intergenic
1195285345 X:103377296-103377318 CTGGAGGGAGGGGCTTTAATTGG + Intronic
1195387170 X:104324328-104324350 TGGGAGGAAGTGGCTTTTGTCGG - Intergenic
1195844201 X:109208904-109208926 CTGGGGAAAGGGGCTGTTGTGGG - Intergenic
1196545670 X:116962171-116962193 CTGGGGGAAGGGGCGGTTGTGGG - Intergenic
1199688284 X:150284222-150284244 TTGGAGGTAAGGGCTTTGGGAGG - Intergenic
1201406111 Y:13652150-13652172 CTGGGGGAAGGGGCAGTTGTGGG - Intergenic
1201490927 Y:14540369-14540391 CTGGGGGAAAGGGCAGCTGTGGG + Intronic
1201608750 Y:15816645-15816667 CTGGAGGAAAGGGCAACTGTGGG + Intergenic