ID: 1190599660

View in Genome Browser
Species Human (GRCh38)
Location X:52077411-52077433
Sequence TGCTCCCAATACGCCTGAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 47
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 42}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190599656_1190599660 25 Left 1190599656 X:52077363-52077385 CCCTGTTGAAGCCATGCTTGTTG 0: 2
1: 0
2: 0
3: 18
4: 134
Right 1190599660 X:52077411-52077433 TGCTCCCAATACGCCTGAACTGG 0: 1
1: 0
2: 1
3: 3
4: 42
1190599657_1190599660 24 Left 1190599657 X:52077364-52077386 CCTGTTGAAGCCATGCTTGTTGG 0: 2
1: 0
2: 2
3: 2
4: 83
Right 1190599660 X:52077411-52077433 TGCTCCCAATACGCCTGAACTGG 0: 1
1: 0
2: 1
3: 3
4: 42
1190599655_1190599660 26 Left 1190599655 X:52077362-52077384 CCCCTGTTGAAGCCATGCTTGTT 0: 2
1: 0
2: 0
3: 16
4: 154
Right 1190599660 X:52077411-52077433 TGCTCCCAATACGCCTGAACTGG 0: 1
1: 0
2: 1
3: 3
4: 42
1190599659_1190599660 14 Left 1190599659 X:52077374-52077396 CCATGCTTGTTGGTCTTAGCGAC 0: 1
1: 0
2: 1
3: 3
4: 46
Right 1190599660 X:52077411-52077433 TGCTCCCAATACGCCTGAACTGG 0: 1
1: 0
2: 1
3: 3
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190599660 Original CRISPR TGCTCCCAATACGCCTGAAC TGG Intergenic