ID: 1190601537

View in Genome Browser
Species Human (GRCh38)
Location X:52097827-52097849
Sequence AACAGCTCTTGGTCTGCTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 685
Summary {0: 3, 1: 11, 2: 59, 3: 255, 4: 357}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190601537_1190601542 15 Left 1190601537 X:52097827-52097849 CCAGTAGCAGACCAAGAGCTGTT 0: 3
1: 11
2: 59
3: 255
4: 357
Right 1190601542 X:52097865-52097887 AATTATCTGAGGATAATGGCAGG 0: 1
1: 1
2: 2
3: 184
4: 2497
1190601537_1190601541 11 Left 1190601537 X:52097827-52097849 CCAGTAGCAGACCAAGAGCTGTT 0: 3
1: 11
2: 59
3: 255
4: 357
Right 1190601541 X:52097861-52097883 GAATAATTATCTGAGGATAATGG 0: 1
1: 0
2: 4
3: 36
4: 523
1190601537_1190601540 4 Left 1190601537 X:52097827-52097849 CCAGTAGCAGACCAAGAGCTGTT 0: 3
1: 11
2: 59
3: 255
4: 357
Right 1190601540 X:52097854-52097876 AAAAGGAGAATAATTATCTGAGG 0: 1
1: 0
2: 14
3: 71
4: 687
1190601537_1190601543 16 Left 1190601537 X:52097827-52097849 CCAGTAGCAGACCAAGAGCTGTT 0: 3
1: 11
2: 59
3: 255
4: 357
Right 1190601543 X:52097866-52097888 ATTATCTGAGGATAATGGCAGGG 0: 1
1: 1
2: 0
3: 33
4: 305

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190601537 Original CRISPR AACAGCTCTTGGTCTGCTAC TGG (reversed) Intergenic
900434961 1:2625612-2625634 GACAGCTCTTGGCCCGTTACTGG + Intronic
901444630 1:9300560-9300582 GACAGCTCTTGGCCTAATACTGG + Intronic
901904048 1:12392648-12392670 GACAGCTCTTGGCCTGTTACTGG - Intronic
902817515 1:18924749-18924771 AACAGCTCCTGGACTGCTGAGGG - Intronic
904179491 1:28655935-28655957 GACAGCTCTTGGCCTATTACTGG - Intergenic
904318343 1:29680415-29680437 GACACCTCTGGGTCTGCTCCTGG - Intergenic
904335935 1:29798022-29798044 GACAGCTCTTGGCCTATTACTGG + Intergenic
904419577 1:30383013-30383035 AATAGCTCCTGGCTTGCTACTGG - Intergenic
904688676 1:32277518-32277540 CACCCCTCTTGGTCTGTTACTGG + Intronic
905465227 1:38148135-38148157 AACAGCTCTTAGCCTGTTACTGG + Intergenic
905729805 1:40289377-40289399 AATAACTTTTGGTTTGCTACTGG - Intronic
905937849 1:41839110-41839132 TCCAGTTCTTGGTCTGCCACAGG + Intronic
906050491 1:42867450-42867472 GACAGCTCTTGGCCTGTTACTGG + Intergenic
906229145 1:44146109-44146131 ACCTGCTCTAGGTCTGCTTCTGG + Intergenic
907780344 1:57560870-57560892 GTCAGCTCTTGGCCTGTTACTGG + Intronic
909063683 1:70907476-70907498 AGCAGCTTTTGGTATGCTACTGG + Intronic
909152735 1:72028842-72028864 AAGAGCTCTTGGTCTAATAAGGG - Intronic
909576923 1:77185894-77185916 GACAGCTCTTGGCCTGTTACTGG + Intronic
909810956 1:79931373-79931395 GACAGCTCTTGGCCTGTTACTGG + Intergenic
910112737 1:83700250-83700272 AACAGCTGTCAGTCTGGTACAGG - Intergenic
910169057 1:84358533-84358555 AATAGCTCCTGGTGTGTTACTGG - Intronic
910370637 1:86512164-86512186 GACAGCTCTTGGCCTGTTACTGG + Intergenic
910559941 1:88579352-88579374 CACAGCTCTTGACATGCTACTGG + Intergenic
910561903 1:88600017-88600039 GACAGCTCTTGGCCTGTTATTGG + Intergenic
910630224 1:89346288-89346310 GGCAGCTCTTGGCCTGTTACTGG + Intergenic
910638988 1:89439938-89439960 GACAACTCTTGGCCTGTTACTGG - Intergenic
910790324 1:91043756-91043778 GACAGCTGTTGGCCTGTTACTGG + Intergenic
910948217 1:92616724-92616746 GACAGCTGTTGGCCTGTTACTGG + Intronic
911109095 1:94164169-94164191 GACAACTCTTGGCCTGTTACTGG - Intronic
911257322 1:95647328-95647350 GGCAGCTCTTGGCCTGTTACTGG - Intergenic
911642334 1:100302588-100302610 AACAGATCTTGGTTTTCTACGGG + Intergenic
911738395 1:101361883-101361905 CACAGCTCTTGGCCTGTTACTGG - Intergenic
912045012 1:105443170-105443192 AAGAGTTCTGGGTCTGCTCCTGG + Intergenic
912067025 1:105756983-105757005 GACAGCTCTTGGCCTGTTACTGG + Intergenic
912129909 1:106588014-106588036 GACAACTCTTGGCCTGTTACTGG - Intergenic
912172205 1:107114220-107114242 AACAGCTTTTGATCTGCAGCGGG - Intergenic
912212255 1:107568930-107568952 GACAGCTCTTGGATTGCTACTGG + Intergenic
912252026 1:108021352-108021374 GACAGCTCTTGGGTTGTTACTGG - Intergenic
912733320 1:112128793-112128815 GACAGCTCTTGGCCTGTTACTGG - Intergenic
913039444 1:115008359-115008381 GACAGCTCTTGTCCTGTTACTGG - Intergenic
915667667 1:157459607-157459629 GACAGCTCTTGGTCTGTTGCGGG - Intergenic
916106327 1:161435291-161435313 GACAGCTCTTGGCCTGTTACTGG - Intergenic
916209806 1:162351214-162351236 AACAGCACTTAGTATGCTTCAGG - Intronic
916285319 1:163099564-163099586 GACAGCTCTTGGCCTGTTACTGG + Intergenic
916365965 1:164028051-164028073 AACAGCTCTTGGTCTGCTACTGG - Intergenic
916369829 1:164079832-164079854 AATAGCTTTTGGCCTGTTACTGG + Intergenic
917217211 1:172690877-172690899 GGCAGCTCTTGGTCTGTTACTGG - Intergenic
917276498 1:173337230-173337252 AACAACTCTTGGCCTGCTACTGG + Intergenic
917462710 1:175246219-175246241 GACAGCTCTTGGCCTGTTACTGG + Intergenic
918439543 1:184553016-184553038 TAAAGCTCTTGGTCTACTCCTGG + Intronic
918667376 1:187168353-187168375 AGCAGTTCTTCGTTTGCTACTGG + Intergenic
918815080 1:189171264-189171286 ACCAGCTCTTGGTCTGTTACTGG + Intergenic
918918229 1:190671843-190671865 GACAGCTCTTGGCCTGTTAATGG - Intergenic
918958248 1:191237985-191238007 GACAGCTCTTGGCCTGTTACTGG + Intergenic
919935274 1:202246565-202246587 AGCAGCTCTTGGTCTGATGTAGG + Intronic
920197433 1:204238402-204238424 GACACCTGTTGGTCTGTTACTGG + Intronic
921387883 1:214589077-214589099 AGCAGCTCCTGTTGTGCTACTGG - Intergenic
921619822 1:217313173-217313195 GACAGCTCTTGGTCTGCCACTGG + Intergenic
921712019 1:218382266-218382288 AAGAGCTCTTAATCAGCTACTGG + Intronic
923253567 1:232199401-232199423 GACAGCTCTTGGCCTGTTACTGG - Intergenic
924182506 1:241453205-241453227 GACAGTTCTTGGCCTGCTACTGG - Intergenic
924323152 1:242869577-242869599 AACAACTCCTGGCCTGCTGCTGG - Intergenic
924477396 1:244394165-244394187 GACAACTCTTGGCCTACTACTGG - Intergenic
924840774 1:247707796-247707818 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1064545686 10:16448099-16448121 GACAGCTCTTGGCCAGTTACTGG - Intronic
1065005328 10:21374200-21374222 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1066164059 10:32766586-32766608 AACAGTTCTTGGCCTGCTATTGG + Intronic
1066167025 10:32799194-32799216 GTCAGCTCTTGGCCTGTTACTGG - Intronic
1067518968 10:46980521-46980543 AACAGCTTTTGGCCTGCTACTGG + Intronic
1067637269 10:48010290-48010312 AGCAGCTCCTGATCTGGTACGGG - Intergenic
1067643278 10:48071313-48071335 AACAGCTTTTGGCCTGCTACTGG - Intergenic
1068007671 10:51409534-51409556 GACAGCTCTTGGCCTGTCACTGG - Intronic
1068447212 10:57138629-57138651 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1068837214 10:61568342-61568364 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1069145765 10:64890476-64890498 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1069192303 10:65506334-65506356 GACAGCCCTTGGCCTGTTACTGG - Intergenic
1069790829 10:71019547-71019569 GACAGCCCTTGGCCTGTTACTGG - Intergenic
1070133863 10:73674719-73674741 CACAGCTCCTGATCTGGTACGGG - Exonic
1071267084 10:83973966-83973988 GACAGCCCTTGGCCTGTTACTGG - Intergenic
1071673925 10:87637393-87637415 GACAGCTTTTGGCCTGTTACTGG - Intergenic
1071920063 10:90339732-90339754 AACAGCTCTTGACTTTCTACTGG + Intergenic
1071937690 10:90549312-90549334 GACAGCTCTTGGCCTGTTCCTGG + Intergenic
1071947084 10:90657695-90657717 GATAGCTCTTGGTCTGCTACTGG - Intergenic
1073224164 10:101902646-101902668 CACAGCTCTTTGTCTGCAACAGG + Intronic
1073557351 10:104465936-104465958 GACAGCTCTTGGTCTGTTACTGG + Intergenic
1073656679 10:105424448-105424470 TACAGCTCTTGGCCTGTTACTGG - Intergenic
1073918474 10:108432279-108432301 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1073957680 10:108891617-108891639 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1074632512 10:115274014-115274036 AACAGCTCTTAGTCTGCTACTGG - Intronic
1075606791 10:123817435-123817457 GACAGCACTTGGCCTGTTACTGG + Intronic
1075778346 10:125002069-125002091 AACAGCTCTTCCTGTGCTCCAGG - Intronic
1076772627 10:132674803-132674825 GACAGCTCTTGGCCTGTTACTGG - Intronic
1076927414 10:133499190-133499212 GACAGCTCTTAGCCTGTTACTGG - Intergenic
1077401202 11:2358505-2358527 AACAGCTCTTGCCCTGCTTCTGG + Intergenic
1077559436 11:3249345-3249367 AACAGGCCATGGACTGCTACTGG + Intergenic
1077565329 11:3295148-3295170 AACAGGCCATGGACTGCTACTGG + Intergenic
1078367500 11:10718875-10718897 AATAGCTCCTGCTCAGCTACGGG + Intergenic
1080020138 11:27551630-27551652 GACAGCTCTGGGCCTGCTACTGG - Intergenic
1080076595 11:28157531-28157553 GACAGCTCTTGGCCTGTTACTGG + Intronic
1081110479 11:39128429-39128451 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1081447720 11:43146538-43146560 TACAGATCTGTGTCTGCTACTGG - Intergenic
1081609063 11:44547888-44547910 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1082671701 11:56043052-56043074 GATAGCTCTTTGCCTGCTACTGG + Intergenic
1083093146 11:60221137-60221159 AAGAGCTCTTGCCCTGTTACTGG + Intronic
1083423459 11:62569844-62569866 AAAAGCTCTTGGACTGATGCTGG - Intronic
1085079268 11:73620732-73620754 AACAGCTCTTGGCCTGCTACAGG + Intergenic
1085381978 11:76128117-76128139 AACAGGACATGGACTGCTACTGG - Intronic
1085684622 11:78610427-78610449 AACAGCTCTTGGCCTGATACTGG + Intergenic
1085685964 11:78622200-78622222 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1085747572 11:79128250-79128272 GACAGCTCTTGGCCTGTTACTGG + Intronic
1086278614 11:85160462-85160484 AACAGCTCTTGGCCTGTTATTGG + Intronic
1086834117 11:91600403-91600425 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1087021603 11:93608717-93608739 AATAGCTCTTGGCCTGCTACTGG - Intergenic
1087779709 11:102289372-102289394 TACAGCTCTTGGCCTACAACAGG + Intergenic
1088097206 11:106115168-106115190 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1088191659 11:107234480-107234502 GACAGTTCTTGGCCTGTTACTGG - Intergenic
1088407610 11:109498652-109498674 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1088836657 11:113583399-113583421 GACAGCTCTTGGCCTGTCACTGG + Intergenic
1089903607 11:122013619-122013641 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1090209491 11:124908040-124908062 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1090221614 11:125031575-125031597 GACAGCTCTTAGCCTGTTACTGG - Intronic
1090753985 11:129772576-129772598 GACAATTCTTGGTCTGCTACTGG - Intergenic
1090754632 11:129779109-129779131 CACAGTTCATGGGCTGCTACTGG + Intergenic
1091076753 11:132625682-132625704 AACAGCTCATGGTCTGGTTTTGG - Intronic
1091103473 11:132897270-132897292 GAGAGCTCTTGGCCAGCTACTGG + Intronic
1091212419 11:133873535-133873557 AACAGCTTTTGGCGTACTACTGG + Intergenic
1092093285 12:5821661-5821683 GACAGCTCTTGGCCTGTTACAGG + Intronic
1092535139 12:9379888-9379910 TACAGCTCATGGCCTGGTACAGG + Intergenic
1092583923 12:9876875-9876897 AATAGCTCCTGGCATGCTACTGG + Intergenic
1092656052 12:10686559-10686581 AACAACTCTTGGTGTGCTACTGG - Intergenic
1093031869 12:14295939-14295961 GACAGCTGTTGGCCTGTTACTGG - Intergenic
1093036338 12:14335694-14335716 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1093049669 12:14490952-14490974 GACAGCTCTTGGCCTGTTAAAGG - Intronic
1093645730 12:21583681-21583703 GAAAGCTCTTGGCCTGTTACTGG + Intronic
1093742486 12:22704583-22704605 AATAGCTGTTGGTATGCTACTGG + Intergenic
1094102532 12:26779273-26779295 GACAGCTCTTGGTCTGGTACTGG + Intronic
1095603855 12:44044345-44044367 GACAGCTCTTGGCCTGTTTCTGG + Intronic
1095844394 12:46729957-46729979 AACAGCTCTTGGCCTGTTAATGG - Intergenic
1095856239 12:46863664-46863686 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1096288713 12:50322971-50322993 GACAGCTCTTGGCCTGCTACTGG + Intergenic
1096457465 12:51799426-51799448 GACGGCTCTTGGCCTGTTACTGG - Intronic
1096734789 12:53644211-53644233 AGTAGCTCTTGGCCTGCTACTGG + Intronic
1097077001 12:56402452-56402474 GACAGCTCTTGACCTGTTACTGG + Intergenic
1097313936 12:58152125-58152147 AACAGCCCTTGGTCTGCTACTGG - Intergenic
1097437837 12:59572243-59572265 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1097564647 12:61252418-61252440 GACAGCTCTTGACCTGTTACTGG - Intergenic
1097646491 12:62240737-62240759 AACAGACCATGGACTGCTACCGG - Intronic
1097821340 12:64131853-64131875 GACAGCTCTTGGCCTGTTACTGG - Intronic
1097843356 12:64342750-64342772 AACAGCTCTTGGCCTGTTACTGG - Intronic
1098158369 12:67623628-67623650 AACAGCTTTTGGGCTGCTACTGG + Intergenic
1098589212 12:72190023-72190045 AACTGCTCTTGGCTTGCTACTGG + Intronic
1098673042 12:73254255-73254277 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1098731052 12:74037359-74037381 GACAGCTGTTGGCCTGTTACTGG + Intergenic
1098745701 12:74234606-74234628 AACAGATCTCGGCCTGCTCCTGG + Intergenic
1098807198 12:75034984-75035006 AACAGCTCTTGGACTGGTACTGG + Intergenic
1099365925 12:81765395-81765417 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1099379381 12:81936529-81936551 GGCAGCTCTTGGCCTGTTACTGG - Intergenic
1099508562 12:83507198-83507220 GACAGCTCTTGGCCTGCTACTGG + Intergenic
1099689781 12:85938048-85938070 GACAGCTCTTTGTCTGTTACTGG + Intergenic
1099995064 12:89769519-89769541 AATACCTCTTGGCCTACTACTGG - Intergenic
1100083304 12:90878223-90878245 GACAGCTCTTTGCCTGTTACTGG + Intergenic
1100241151 12:92711597-92711619 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1101222656 12:102657408-102657430 AACAGCTCTTGACCTCCTACTGG + Intergenic
1101534667 12:105606093-105606115 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1101543072 12:105682647-105682669 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1101697456 12:107139819-107139841 AAAAGCTCTTGGCCTGCTACTGG - Intergenic
1101852847 12:108418037-108418059 AGCAGCTCTGGGCTTGCTACTGG - Intergenic
1102211234 12:111128678-111128700 AACAGCTCTTGGTTTGCTACTGG - Intronic
1103396528 12:120611458-120611480 GACAGCTCTTGACCTGTTACTGG + Intergenic
1104418520 12:128615729-128615751 AACAGCCCATGGACTGGTACCGG + Intronic
1105033251 12:132899875-132899897 ACCAGCTTTTGGCTTGCTACAGG - Intronic
1105740110 13:23315187-23315209 GACAACTCTTGGCCTGTTACTGG + Intronic
1106590327 13:31092999-31093021 AAGAGCTCATGGTGTGCTACAGG + Intergenic
1106762090 13:32877325-32877347 AGCAGTTCTTGGCATGCTACTGG + Intergenic
1106905537 13:34405420-34405442 AATAGCTCCTGGTGTGTTACTGG - Intergenic
1107505170 13:41026628-41026650 GACAGCTCTTGACCTGCTACTGG + Intronic
1107974038 13:45672232-45672254 CACAGCTCTTGTTCTGATCCGGG + Intergenic
1107983575 13:45755961-45755983 GACAGCTCTTGGCCTATTACTGG - Intergenic
1108302433 13:49091974-49091996 GACAGCTCTTGGCCCGTTACTGG - Intronic
1108820345 13:54342019-54342041 AACAGCACTGGGAATGCTACTGG - Intergenic
1109293225 13:60500129-60500151 GACGGCTCTTGGCCTGTTACTGG + Intronic
1109519023 13:63484812-63484834 GACAGCTCTTGGCTTGTTACTGG + Intergenic
1109583049 13:64366178-64366200 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1109705068 13:66079234-66079256 AACAACTGTTGACCTGCTACTGG + Intergenic
1109712680 13:66180811-66180833 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1109933291 13:69245164-69245186 AACAGTTCTTGGCCTGCTATCGG - Intergenic
1109951023 13:69502194-69502216 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1110330453 13:74266302-74266324 AACAACTCTTGAAATGCTACTGG + Intergenic
1110377173 13:74806480-74806502 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1110834134 13:80064618-80064640 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1111057798 13:82973016-82973038 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1111317503 13:86581812-86581834 GAGAGCTCTTGGCCTGTTACTGG + Intergenic
1111432252 13:88159623-88159645 GACAGATCTTGGCCTGCTACTGG - Intergenic
1111470896 13:88681047-88681069 AATAGCTTTTGGTTTGCTAGTGG - Intergenic
1112231126 13:97590153-97590175 GATAGCTCTTGGTTTGTTACTGG - Intergenic
1112249926 13:97770267-97770289 GACAGCTCTTGGGCTGTTACTGG - Intergenic
1112323012 13:98424081-98424103 GACAGCTATTGGTCTGCTTCAGG + Intronic
1112582570 13:100689158-100689180 AACAGCTTTAAGTCTTCTACAGG + Intergenic
1114205871 14:20570780-20570802 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1114599210 14:23940801-23940823 AACAACTCTTTATCTGCTACGGG + Intergenic
1115070785 14:29319635-29319657 AACAGCTCTTAGCCTGCTACTGG + Intergenic
1115130694 14:30049271-30049293 GACAGCTCTTGGCCTGTCACTGG + Intronic
1115143400 14:30199398-30199420 GGCAACTCTTGGCCTGCTACTGG + Intergenic
1115292242 14:31785311-31785333 AACAGACCATGGTCTGGTACTGG - Intronic
1115310868 14:31976490-31976512 AACAGTTTTTGGCCTGCTACTGG - Intergenic
1115327940 14:32163959-32163981 AACAGCTCCTGGTATGTTCCTGG + Intergenic
1116058909 14:39896949-39896971 GACAGCTCTTGGCCTGTTGCTGG + Intergenic
1116068095 14:40009182-40009204 AACAGCTCTTGGCCTGTTACTGG + Intergenic
1116158377 14:41236654-41236676 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1116308043 14:43283436-43283458 GACAGCTCTTGGCCTGCTACTGG - Intergenic
1116985889 14:51219786-51219808 AACACCTCTTAGTCTGTTGCTGG + Intergenic
1117216844 14:53560186-53560208 GACACCTCTTGGCCTGTTACTGG + Intergenic
1117634134 14:57724384-57724406 GACAGCTGTTGGCCTGTTACTGG + Intronic
1118122433 14:62860159-62860181 GACAGCTCTTAGCCTGTTACTGG - Intronic
1118385501 14:65252534-65252556 GACAGCTCTTGGTCTGCTACTGG - Intergenic
1118501835 14:66369400-66369422 GATAGCTCTTGGCCTGCTACTGG + Intergenic
1118526419 14:66649385-66649407 AACAGGTCACGGACTGCTACTGG - Intronic
1118880773 14:69824007-69824029 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1119023389 14:71133857-71133879 AACAGCTCCTGGTTTGCCCCTGG - Intergenic
1119059696 14:71462179-71462201 GACAGCTCTTTGTCTGTTACTGG - Intronic
1119107563 14:71938828-71938850 GACAGCTCTTGGCCTATTACTGG - Intronic
1120169407 14:81233997-81234019 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1120231422 14:81845240-81845262 GACAGCTGTTGGCCTGTTACTGG - Intergenic
1120555991 14:85930427-85930449 AGCAGCTCTTGGCCTGTTACTGG - Intergenic
1120710468 14:87788080-87788102 AACAGCTTTTGGCTTGCTATTGG - Intergenic
1120733730 14:88030578-88030600 TGCAGCTCCTGGCCTGCTACCGG - Intergenic
1120973704 14:90230837-90230859 AGAAGCTCTTGGCCTGTTACTGG + Intergenic
1123908497 15:24943643-24943665 AACAGCTGTTGGCCTGCTACTGG - Intronic
1124100409 15:26687744-26687766 AACAGCTCCAGATATGCTACAGG - Intronic
1124571703 15:30870365-30870387 AGCAGCTTTTGGCTTGCTACTGG + Intergenic
1124577821 15:30925350-30925372 AACAGCTCTTAGGATGCTTCTGG - Intronic
1126191311 15:45881793-45881815 AATAGTTCTTGGTATGCTGCTGG - Intergenic
1126283611 15:46986288-46986310 AACAACTCTTGGCCTGTTATTGG + Intergenic
1127356917 15:58209200-58209222 GACAGCTCTTGGCCTGTTATTGG + Intronic
1127506188 15:59600121-59600143 ATCGGCTCTTGGTCTCCTAAAGG + Intronic
1129318965 15:74763239-74763261 AACAGCTCCTCATCTGCTCCTGG - Intergenic
1130145947 15:81273746-81273768 AAGAGCTCATGATCTGCCACAGG + Intronic
1131724011 15:95202806-95202828 GACAGCTCTTGGCCTGTTACCGG + Intergenic
1132305739 15:100810856-100810878 AACAGCTCTTGGCCTGCTACTGG - Intergenic
1132427169 15:101727498-101727520 AGCAGCTTCTGGTTTGCTACTGG + Intergenic
1135626004 16:23995507-23995529 GACAGCTCTTGGCCTGCTACCGG + Intronic
1135688077 16:24514375-24514397 AGCAGCTCCTGGCATGCTACTGG + Intergenic
1138318836 16:56093752-56093774 GACAGATCTCGGTCTGCTACTGG - Intergenic
1138891800 16:61151903-61151925 AACAGCCCTAGCTCTGCTTCAGG - Intergenic
1141559542 16:84858027-84858049 GACAGCTCTTGGCCTGTTACTGG - Intronic
1142588381 17:988573-988595 CACAGCTTTTGGACTGCTACTGG - Intergenic
1145028910 17:19489702-19489724 CACAGCTCTTGGTGTGCTGCAGG + Intergenic
1146237984 17:31185959-31185981 TACAGCTCTTGACCTGTTACTGG + Intronic
1146836356 17:36114011-36114033 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1146850934 17:36221051-36221073 GACAGCTCTTAGCCTGTTACTGG + Intronic
1149731001 17:58946098-58946120 AGCAGTTCTTGGTGGGCTACTGG - Intronic
1152303186 17:79507157-79507179 AGCACCGCTTGGTCTGCTGCAGG - Intronic
1203163028 17_GL000205v2_random:69135-69157 AGCAGCTGTTGACCTGCTACTGG + Intergenic
1153089710 18:1330169-1330191 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1153217693 18:2835595-2835617 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1154129536 18:11724817-11724839 AACAACCCTTGGCCTGCTCCTGG - Intronic
1154254464 18:12770477-12770499 AACAGTTTTTGGCTTGCTACCGG + Intergenic
1154506173 18:15042897-15042919 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1155336981 18:24774747-24774769 AACGGTTCTTGATCTACTACTGG - Intergenic
1155940708 18:31799605-31799627 GACAGCTCTTGGTCTGTTACTGG + Intergenic
1156303861 18:35858701-35858723 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1156342226 18:36220067-36220089 AGCAGCCCTTGGTTTCCTACAGG - Exonic
1157341203 18:46780034-46780056 GACAACTCTTGGCCTGTTACTGG + Intergenic
1157870931 18:51229574-51229596 GATAGCTCTTGGTCTGCTACTGG - Intergenic
1157998504 18:52588117-52588139 GACAGCTCTTGGCCTGTTACTGG - Intronic
1159152205 18:64535031-64535053 GACAGCTCTTGGCATGTTACTGG - Intergenic
1159287789 18:66375489-66375511 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1159464685 18:68766260-68766282 TACAGCACTTTGTCTGCTAATGG - Intronic
1159559104 18:69975344-69975366 GACAGCTCTTGGCTTGTTACTGG - Intergenic
1159656491 18:71034486-71034508 AACATCTCTTAATGTGCTACTGG + Intergenic
1159711301 18:71764131-71764153 GACAACTCTTGGTTTGTTACTGG + Intronic
1160092464 18:75840022-75840044 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1161922108 19:7274359-7274381 AACAGGACATGGACTGCTACTGG + Intronic
1162311357 19:9909344-9909366 GACAGCTCTTAGTCTGGTCCTGG + Intronic
1163864907 19:19764891-19764913 AACAGCTTTTGGCCTGTTCCTGG + Intergenic
1164117257 19:22234567-22234589 GACAACTCTTGGCCTGTTACTGG - Intergenic
1167949518 19:53015047-53015069 AAGAGCTCTGGGTCTAATACTGG + Exonic
1167954087 19:53050208-53050230 AAGAGCTCTGGGTCTAATACTGG + Exonic
925279953 2:2676875-2676897 GACAGCACTTGGCCTGTTACTGG + Intergenic
925460727 2:4060453-4060475 GACAGCTCTTTGTCTATTACTGG + Intergenic
925809996 2:7690550-7690572 AACTACTCTTGGTCTGATATTGG - Intergenic
926810395 2:16750669-16750691 GACAGCTCTTGGCCTGTTACTGG - Intergenic
926826763 2:16913675-16913697 GACAGATCTTGGCCTGTTACTGG + Intergenic
927008718 2:18879731-18879753 GACAGCTCTTGGCCTGTTACTGG + Intergenic
927660433 2:24988676-24988698 GACGGCTCTTGGCCTGTTACTGG + Intergenic
929269825 2:39960774-39960796 AACAGCTCTTGGCCTGTTACTGG - Intergenic
929550262 2:42886039-42886061 GACAACTCTTGGACTGTTACTGG + Intergenic
930295402 2:49547502-49547524 AAGAGCTCTTGGCCGGTTACTGG - Intergenic
930994268 2:57697379-57697401 CACAGCTCCTGGTATGCTAATGG - Intergenic
932870706 2:75395074-75395096 GACAGCTCCTGGCCTGTTACTGG - Intergenic
933265684 2:80178373-80178395 GACAGCTCTTGGCCTGTTACTGG - Intronic
933394462 2:81713348-81713370 GACAGCTCTTGGCCTGTTACTGG - Intergenic
935028089 2:99296510-99296532 AACAGCCCTGGTTCTCCTACTGG + Intronic
935183936 2:100714908-100714930 GACAGCTCTTGGCCTGTTACTGG + Intergenic
935391355 2:102556412-102556434 AACAGCTGTTGGCATGCTACTGG - Intergenic
935425109 2:102911318-102911340 TACAGCTCTTGGCCTGTTACTGG - Intergenic
935564308 2:104590244-104590266 GACAGCTCTTGGCCTGTTACTGG - Intergenic
935823225 2:106915233-106915255 AGCAGCTCTTGGCTTGCTACTGG + Intergenic
935944629 2:108274356-108274378 GACAGCTCTTGGCCTGCTACTGG - Intergenic
936084991 2:109461298-109461320 GATAGTTCTTGGTCTGCCACTGG - Intronic
936641226 2:114314699-114314721 GACAGCTCTTGGCCTGTTACTGG + Intergenic
936833869 2:116683247-116683269 AACAGCTCCTGGCTTGCTACTGG + Intergenic
937006953 2:118525593-118525615 AACTGCTTTTGGCTTGCTACTGG + Intergenic
937785205 2:125887719-125887741 GACAGCTCTTGGCCTGTTACTGG - Intergenic
937852569 2:126648729-126648751 GACAGCACTTGGCCTGTTACTGG - Intergenic
938375539 2:130803381-130803403 GACAGCTCTTGGCCTGCTACCGG + Intergenic
938709579 2:133964651-133964673 AACAGCTTTTGTCTTGCTACTGG + Intergenic
939069063 2:137517865-137517887 GGCAGCTCTTGGCCTGTTACTGG + Intronic
939213873 2:139212249-139212271 GACAGCTCTTGGCCTGTTATTGG + Intergenic
939227837 2:139386007-139386029 AACTGGTCCTGGTATGCTACTGG - Intergenic
939689440 2:145239341-145239363 AACTGCTCTTACTCTGTTACAGG - Intergenic
939788685 2:146546104-146546126 GACAACTCTTGGCCTGTTACTGG - Intergenic
940605915 2:155924279-155924301 GACAGCTCATGGCCTGTTACTGG - Intergenic
941330667 2:164174556-164174578 GACAGCTCTTTGCCTGTTACTGG - Intergenic
943239218 2:185362563-185362585 GACAACTCTTGGCCTGTTACTGG - Intergenic
943317928 2:186412310-186412332 GACAGCTCTTGGTCTGTTACTGG - Intergenic
943388130 2:187227145-187227167 GGCAGCTCTTGGCCTGTTACTGG + Intergenic
943517597 2:188907233-188907255 GACATCTCTTGGCCTGTTACTGG - Intergenic
943799893 2:192044787-192044809 AACAGTTCTTAGTTTGCTACTGG + Intronic
944864779 2:203849683-203849705 AAAAGCTCTTGATTTGTTACTGG + Intergenic
945642179 2:212443846-212443868 GACAGCTCTTGGACTATTACTGG + Intronic
945717834 2:213380660-213380682 GACAGCTCTTGGCCTGTTACTGG - Intronic
945725844 2:213471486-213471508 GACAGATGTTGGTCTGTTACTGG - Intronic
945849283 2:214985955-214985977 AACAGCTTATGTTCTGCTCCTGG + Intronic
946527867 2:220539958-220539980 GACAGCTCTTGGCCCGTTACTGG - Intergenic
946790922 2:223299769-223299791 GACAGCTCTTGGCCTGTTACTGG + Intergenic
947235378 2:227935991-227936013 AACAGCTCCTGTTCTGAGACTGG + Intergenic
1171409817 20:24938619-24938641 AGCAGCTCTTGGCCTGCCACTGG - Intergenic
1171436121 20:25125957-25125979 AGCAGCTCTTGGCCTGCCACTGG + Intergenic
1176791680 21:13326127-13326149 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1176998161 21:15580193-15580215 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1177139415 21:17342260-17342282 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1177192843 21:17870906-17870928 GACAGCTCTTTGACTGCTACTGG - Intergenic
1177505560 21:22014173-22014195 GACAGCTTTTGGCCTGCTACTGG - Intergenic
1177781014 21:25622415-25622437 AACAGCTTTTGGCCTGCTATTGG - Intergenic
1177913176 21:27056219-27056241 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1177933697 21:27316923-27316945 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1178012661 21:28305184-28305206 GACAGCTCTTGGCCTGCTACTGG + Intergenic
1178060754 21:28851129-28851151 AACAGTTCTTGGCCTGTTACTGG - Intergenic
1178063299 21:28875348-28875370 AACAGCTCTTGGCCTGCTACTGG - Exonic
1178634467 21:34290206-34290228 GACAGCTCTTGGCCTGCTACTGG + Intergenic
1178813501 21:35905869-35905891 AGTAGCTCTAGGTCTGCAACTGG - Intronic
1179383528 21:40921059-40921081 GACAGCTCTTGGCCTGCAACTGG + Intergenic
1179415149 21:41192512-41192534 GAGAGCTCTTGGCCTGTTACTGG - Intronic
1180591146 22:16938358-16938380 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1181367436 22:22388935-22388957 GACAGCTCTTGGCCTATTACTGG - Intergenic
1181420654 22:22795840-22795862 GACAGCTGTTGGCCTGTTACTGG + Intronic
1184603560 22:45558366-45558388 GACAGCTCTTGGCCTGTTACTGG - Intronic
1184638696 22:45857031-45857053 AACAGCCCTTGGCCTACTGCCGG - Intergenic
1185033673 22:48459528-48459550 AACAGCTCTTGGCTTGCTGCTGG - Intergenic
949170039 3:986595-986617 GACAGCTCTTGGCCTGTTACTGG - Intergenic
949245869 3:1924931-1924953 GACAGCTCTTGGTCTGTTACTGG + Intergenic
949445612 3:4131062-4131084 GACAGCTCTTGGCCTGTTACTGG + Intronic
949905876 3:8858066-8858088 AACAGCTCTTGGCCTACTAGCGG + Intronic
951384526 3:22027543-22027565 GACAGCTCTTGGCCTGTTACTGG + Intronic
951970762 3:28441857-28441879 GACAGCTCTTGGTCTGTTACTGG - Intronic
954054157 3:48007968-48007990 GTCAGCTCTTGGCCTGTTACTGG + Intronic
954511490 3:51129653-51129675 GGCAGCTCTTGGCCTGTTACTGG - Intronic
955314124 3:57921073-57921095 AACAGAGATTGTTCTGCTACTGG - Intronic
955685614 3:61545641-61545663 ATCATTTTTTGGTCTGCTACTGG - Intergenic
956360453 3:68441446-68441468 GATAGCTCTTGGCCTGTTACTGG + Intronic
956509662 3:69980380-69980402 GACAGCTCTTGGCCTATTACTGG + Intergenic
956703894 3:71982879-71982901 GACAGCTCTTGGCCTATTACTGG - Intergenic
957298498 3:78361635-78361657 AACAGCTCTTGGCCTGCTGCTGG - Intergenic
957754598 3:84469434-84469456 GACAGCTCTTGGCCTGTTACTGG + Intergenic
958487677 3:94732466-94732488 GACAGCTCTTGGCCTGTTACTGG - Intergenic
958762117 3:98321454-98321476 AACAGCTCTTGTTCTGCTACTGG - Intergenic
959100166 3:102001093-102001115 AACAGCTCCTAGCCTGCTACTGG - Intergenic
959203650 3:103279237-103279259 AATGGCTCTTGGCCTGTTACTGG - Intergenic
959226778 3:103597268-103597290 GACAGCTTTTGGCCTGTTACTGG - Intergenic
959746013 3:109777265-109777287 GACAGCTTTTGGACTGTTACTGG - Intergenic
959997860 3:112698328-112698350 GAGAGCTCTTGGCCTGCTACTGG + Intergenic
960010847 3:112833449-112833471 AATAGCTCATGGCATGCTACGGG + Intronic
960349530 3:116575709-116575731 GACAGCTCTTGGTCTGTTACTGG + Intronic
962209398 3:133464296-133464318 CACATCTCTGGGTCTGCTGCTGG + Intronic
962654615 3:137530667-137530689 TACAGCTCTTGTTTTGCTATAGG - Intergenic
963115131 3:141721796-141721818 AAGAACTCTTGGTATGTTACTGG + Intergenic
963331816 3:143923365-143923387 GACAGATCTTGGCCTGTTACTGG - Intergenic
963453671 3:145516675-145516697 GACAGCTCTTGGCCTGTTACTGG + Intergenic
964679244 3:159318906-159318928 GACAGCTCATGGCCTGTTACTGG - Intronic
965226766 3:166000756-166000778 GACAGCTCTTGGCCTGTTAGTGG - Intergenic
965251332 3:166348259-166348281 GACAGCTCTTGGTCTGTTACTGG - Intergenic
965708643 3:171534771-171534793 AGCAGCTCTTGGCCTGCTACTGG - Intergenic
965893154 3:173540086-173540108 AACAGCTCTGGGCCTGCTACTGG - Intronic
965959923 3:174416995-174417017 AACAGCTTTTGGTATACTACTGG - Intergenic
966044329 3:175530913-175530935 GACAGCTCTTGGCCTGTTACTGG - Intronic
966215066 3:177493521-177493543 AACAGCTTTTGGGATTCTACTGG - Intergenic
966302847 3:178498108-178498130 AAGGGCTCTTGGTCTGCTGGGGG - Intronic
966445694 3:179998567-179998589 GACAGCTCTTGGTCTGTTACTGG + Intronic
966896732 3:184450552-184450574 AACGGCTCCTGGCCTGTTACTGG - Intronic
967831777 3:193925998-193926020 GACAGCTCTTGGCCTGTTACTGG + Intergenic
968800184 4:2738129-2738151 GACAGCTCTTGGCCTGTTACTGG + Intergenic
968906947 4:3457975-3457997 GACAGCTCTTGGCCTGTTACTGG + Intergenic
969440259 4:7212794-7212816 AACAGCTCTTGATCTTCATCTGG - Intronic
971460482 4:26890511-26890533 AACAGATTTTGGCTTGCTACGGG - Intronic
971897541 4:32617013-32617035 GACAGCTCTTGGCTTGCTACTGG + Intergenic
971979294 4:33732865-33732887 GACAGCTCTTGGCCTGCTATTGG - Intergenic
972805917 4:42529335-42529357 GACAGCTCTTGGCTTGTTACTGG + Intronic
973036724 4:45416419-45416441 AACAGCCCTCAGTCTGCTATTGG + Intergenic
973098053 4:46226768-46226790 GACAGCTCTTGGCCTCCTACTGG + Intergenic
973118443 4:46489051-46489073 GGCAGCTCTTGGCCTGTTACTGG + Intergenic
973120980 4:46520890-46520912 TACAGCTCTTGGCCTGTTACTGG - Intergenic
973143682 4:46798614-46798636 AATAGCTCTTGGCCTGCTACTGG + Intronic
973539875 4:51925072-51925094 AACACCTATTGGCCTGCTAGTGG - Intergenic
974262370 4:59542261-59542283 GACAGCTCTTGGCCTGTTACTGG - Intergenic
974557606 4:63471907-63471929 GTTAGCTCTTGGTCTGCTACTGG + Intergenic
974644615 4:64674756-64674778 GACAGCTCTTGGCCTGTTACTGG - Intergenic
974688529 4:65265598-65265620 AACAGTTTTTGGCCTGCTACTGG + Intergenic
974727213 4:65812531-65812553 AACAGCTCTTGGCCTGTTACTGG + Intergenic
974746914 4:66088897-66088919 GACAGCTCTTGGTCTGTTACTGG - Intergenic
974786408 4:66624111-66624133 AACAGCCCTTATCCTGCTACTGG + Intergenic
975024469 4:69531640-69531662 GACAGCTCATGGCCTGTTACTGG + Intergenic
975386716 4:73767501-73767523 GACAGCTTTTGGCCTGTTACTGG - Intergenic
975982614 4:80177269-80177291 GACAGCTCTTGGCCTGTTACTGG - Intergenic
976034205 4:80795814-80795836 GACAGATCTTGGTCTGTTAGTGG - Intronic
977031623 4:91891415-91891437 GACAGCTCTTTTTCTGTTACTGG + Intergenic
977204717 4:94155692-94155714 GACAGCTCTTGGCCTGTTACTGG + Intergenic
977466002 4:97383382-97383404 GACAACTCTTGGTCTGTTACTGG + Intronic
977490070 4:97700063-97700085 GACAGCTCTTGGCCTGTTACTGG - Intronic
977626275 4:99192646-99192668 GATAGCTCTTGGCCTGTTACTGG - Intergenic
977701730 4:100029879-100029901 GACAGCTCTTGGCCTGTTACTGG - Intergenic
977833274 4:101618160-101618182 GACAGCTCTTGGCCTGTTACTGG - Intronic
977930411 4:102743811-102743833 GACAGCTCTTGGCCTGTTACTGG - Intronic
977976562 4:103273319-103273341 AACGGCTCCTGGCTTGCTACTGG - Intergenic
978772151 4:112467772-112467794 GACAGCTTTTGGCCTGTTACTGG - Intergenic
978899074 4:113926810-113926832 GACAGCTCTTGGCCTGTTACTGG - Intronic
978966853 4:114750950-114750972 GACAGCTCTTGGGCTTTTACTGG + Intergenic
979048208 4:115896546-115896568 AACAGCTTTTGATCTGCTGCTGG + Intergenic
979767021 4:124474603-124474625 GACAGCTCTTGGCCTGTTACTGG + Intergenic
979888567 4:126062165-126062187 GATAGCTCTTGGCCTGCTATTGG - Intergenic
980405890 4:132353783-132353805 GACAGCTTTTGGCCTGTTACTGG - Intergenic
980497526 4:133605354-133605376 GACAGCTCTTGGCCTGTTATTGG - Intergenic
980582283 4:134770782-134770804 AACAGCTTTTGGCCTGCTCCTGG - Intergenic
980629523 4:135414294-135414316 GACAGCTCTTGGCCTGTTACTGG + Intergenic
980957732 4:139445925-139445947 GACAGCTTTTGGCCTGTTACTGG + Intergenic
981160918 4:141497569-141497591 AACAGCTTTTGGACTACTACTGG + Intergenic
981835004 4:149043953-149043975 GACAGCTCTTGGCCTGTTACTGG + Intergenic
982623340 4:157732893-157732915 GACAGCTCTTGGCCTGTTACTGG - Intergenic
982835540 4:160116649-160116671 GAGAGCTCTTGGCCTGTTACTGG + Intergenic
982847770 4:160274304-160274326 GACAGCTCTTGGCCTGTTACTGG + Intergenic
982851048 4:160316648-160316670 AACAGCTTTTGGCCTGCTACAGG - Intergenic
983027391 4:162755303-162755325 GACAGCTCTTGGCCTGTTACTGG + Intergenic
983582676 4:169324820-169324842 GACAGCTCTTGGCTTGTTACTGG + Intergenic
984060283 4:174982016-174982038 GACAGCTCTTGGCCTGCTACTGG - Intergenic
986037032 5:3950429-3950451 GACAGCTCTTGGCCTGTTACTGG - Intergenic
986087110 5:4462726-4462748 GACAGCTCTTGGCCTGTTAGTGG + Intergenic
986505929 5:8451210-8451232 GATAGCTCCTGGTGTGCTACTGG + Intergenic
986742920 5:10719514-10719536 GACAGCTCTTGGCCTGTTACTGG + Intronic
986938331 5:12918742-12918764 GACAGCTCTTGGCCTATTACTGG - Intergenic
987108043 5:14660268-14660290 AACAACTTTTGGTTTGCTACTGG - Intergenic
987153177 5:15061674-15061696 AACAGCTCTTGGCCTGTTACTGG + Intergenic
987468188 5:18296976-18296998 GACAGCTCTTGGCCTATTACTGG - Intergenic
987578340 5:19758303-19758325 GGCAGCTCTTGGCCTGTTACTGG - Intronic
987646373 5:20677321-20677343 GACAGAACTTGGCCTGCTACTGG - Intergenic
987906480 5:24084006-24084028 AACAGCTTTAGGCTTGCTACTGG + Intronic
987918879 5:24252111-24252133 ACCAGCATTTGGTCTGCTAAAGG + Intergenic
988079830 5:26401411-26401433 GACAACTCTTGGCCTGTTACTGG - Intergenic
988188776 5:27901245-27901267 GACAGCTCTTGGCCTGTTACTGG + Intergenic
988228769 5:28448135-28448157 GACAGCTCATGGCCTGTTACTGG + Intergenic
988562131 5:32290856-32290878 GACAGCTCTTGGCCCGTTACTGG + Intronic
989045205 5:37267582-37267604 GACAGCTCTTGGCCTGTTACTGG - Intergenic
989486383 5:41996350-41996372 GACAGCTCTTGGCCTGTTACTGG - Intergenic
989679026 5:44007540-44007562 AACAGCTCTTGGAGTGCTATTGG - Intergenic
991033545 5:62105931-62105953 GACAGCTCTTGGCCTGTTACTGG + Intergenic
991234168 5:64375172-64375194 AACAGCTTTTGGCCTATTACTGG + Intergenic
991946146 5:71900150-71900172 GACAGCTGTTGGCCTGTTACTGG + Intergenic
992109881 5:73482868-73482890 AATATCTCTTGATCTGCTACTGG - Intergenic
992242956 5:74789876-74789898 AACAGTTCTTGGCCTGTTACTGG + Intronic
992344705 5:75865096-75865118 AACAGCTCCTGGCATGTTACTGG + Intergenic
993231900 5:85247524-85247546 GACAGCTCTTGGCCTGTTACTGG - Intergenic
993245137 5:85441307-85441329 AAAAACTCTTGGTATGCTACTGG + Intergenic
993367467 5:87050947-87050969 CACAGCTATTGGTCTGTTACTGG - Intergenic
994117171 5:96073797-96073819 AACAGCTCATGGACCACTACCGG + Intergenic
994144699 5:96381685-96381707 TGCAGCTCTTGGTCTCCTAGGGG + Intergenic
994291372 5:98031962-98031984 GACAGCTCTTGGCCTGTTACTGG - Intergenic
994855434 5:105113575-105113597 GACAGCTCTTGGCATGTTACTGG - Intergenic
994984419 5:106915720-106915742 GACAGCTCTTGGCCTGTTACTGG - Intergenic
995427732 5:112043717-112043739 CAAAGCTCTTGGCCTGTTACTGG - Intergenic
995621342 5:114029514-114029536 AACAGCTCTTGGGTTGCTGCTGG + Intergenic
995776286 5:115727670-115727692 GACAGCTCTTGGCCTGTTACTGG - Intergenic
996018561 5:118567865-118567887 GACAGCTCTTGGTCTGTTACTGG + Intergenic
996164955 5:120212499-120212521 GACAGCTTTTGGCCTGTTACTGG - Intergenic
996381713 5:122868402-122868424 AACAGCGCTTACCCTGCTACTGG - Intronic
996435553 5:123429757-123429779 ACCAGCTCTTCCTCTGCTATTGG - Intergenic
996825564 5:127677844-127677866 GACAGCTCTTGGCCTGTTATTGG + Intergenic
996912233 5:128668983-128669005 AACAGCTCTTGGCCTGTTACTGG + Intronic
998290335 5:140908542-140908564 GACAGCTCTTGGCCTATTACTGG - Intronic
998646612 5:144069158-144069180 AGCAGCTCTTGGTGGGCTCCTGG + Intergenic
999351386 5:150874854-150874876 GACAGCTCTTGGCCTGTCACTGG + Intronic
1000223244 5:159234239-159234261 CACAGCTCTTGGCTTGTTACTGG - Intergenic
1000416973 5:160993911-160993933 GACAGCTCTTGGCCTGTTATTGG + Intergenic
1000422870 5:161058029-161058051 GAGAGCTCTTGGCCTGCTACTGG - Intergenic
1000621618 5:163492929-163492951 AACAGCTCTGGGCCTACTGCTGG - Intergenic
1001173596 5:169444652-169444674 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1001438074 5:171715922-171715944 CACAGATCTAGGTCTGCTGCAGG - Intergenic
1003695897 6:8406130-8406152 GACAGCTCTTGGCCTGTTACAGG - Intergenic
1003758608 6:9150091-9150113 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1003791221 6:9550001-9550023 GACAGCTCTTGGCCTATTACTGG + Intergenic
1004515127 6:16316027-16316049 AACAGGCCATGGACTGCTACTGG - Intronic
1004824288 6:19403226-19403248 GACAGCTCTTGGACTGTTACTGG - Intergenic
1006001557 6:30969085-30969107 GACAGCTCTTGGCCTATTACTGG + Intergenic
1006062352 6:31433232-31433254 GACAGCTCTTAGCCTGTTACTGG + Intergenic
1008266921 6:49439279-49439301 GACAGCTCTTGGCCTGTTACTGG - Intronic
1009390111 6:63135068-63135090 GACAGCTTTTGGCCTGTTACTGG - Intergenic
1009563205 6:65275251-65275273 AACAGCTGTTGGTATGTTACTGG + Intronic
1009660694 6:66606912-66606934 AACAGCTCTTGGCCTGTTACTGG - Intergenic
1009770333 6:68136842-68136864 GATAGCTCTTGGCCTGCTACTGG - Intergenic
1010323578 6:74540499-74540521 GACACCTCTTGGCCTGTTACTGG + Intergenic
1010325329 6:74556589-74556611 GACATCTCTTGGCCTGTTACTGG - Intergenic
1010580752 6:77593895-77593917 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1010938245 6:81886407-81886429 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1011039343 6:83013264-83013286 AACAGGTCTTAGCCTGTTACTGG - Intronic
1011069102 6:83361675-83361697 GACAGCTCCTGGCCTGTTACTGG + Intronic
1011136590 6:84106931-84106953 AGCAGCTCTTTACCTGCTACTGG - Intergenic
1011357477 6:86487565-86487587 ATTACCTCTTGGTGTGCTACTGG + Intergenic
1012362990 6:98406675-98406697 AACAGCTCTTGGCGTGCTACTGG - Intergenic
1012499824 6:99875977-99875999 AACAGGTCATGGACTGGTACTGG + Intergenic
1012730462 6:102874329-102874351 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1012820805 6:104082928-104082950 AACAGTTCTTGGCCTGTTACTGG + Intergenic
1012920794 6:105219535-105219557 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1012964133 6:105655360-105655382 ATCAGCTCTTGTCCTGGTACTGG + Intergenic
1013391038 6:109686725-109686747 AACAGCTCTTGGCATGCTCTTGG + Intronic
1014363396 6:120508344-120508366 GAGAGCTCTTGGCCTGTTACTGG - Intergenic
1014416987 6:121195399-121195421 GACAGCTCTTGGCATGTTACTGG + Intronic
1014538831 6:122649752-122649774 AACAGCTTTTTGCCTGCTACTGG - Intronic
1014895655 6:126896584-126896606 GACAGCTCTTGGCCTGATAATGG + Intergenic
1015095449 6:129409591-129409613 GACAACTCTTGGCCTGTTACTGG - Intronic
1015475750 6:133657501-133657523 GACAGCTCTTGGCTTGTTACTGG + Intergenic
1015862094 6:137691851-137691873 GACAGCTTTTGGCCTGCTCCTGG + Intergenic
1015892632 6:137983760-137983782 AAGAGGTCTAGGTCTGTTACAGG + Intergenic
1016132838 6:140497997-140498019 AACAGCTCTTGGCCTGTAATTGG - Intergenic
1016144291 6:140649412-140649434 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1016147329 6:140692706-140692728 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1016174914 6:141069085-141069107 GACAGTTCTTGGCCTGTTACTGG - Intergenic
1016419614 6:143870672-143870694 GACAGCTCTTGGCCTGTTACTGG - Intronic
1016576257 6:145572577-145572599 GACAGCTCTTGGTCTGTTACTGG - Intronic
1017041201 6:150309890-150309912 AACAGCCCATGGACTGGTACTGG - Intergenic
1017044069 6:150330844-150330866 AACAGCTCTTGGCCTGCTACTGG - Intergenic
1017977115 6:159368047-159368069 GACAGTTCTTGGTTTGTTACTGG - Intergenic
1018122927 6:160655213-160655235 GACAGCTATTGGTCTGTTATTGG - Intronic
1018599888 6:165527536-165527558 GACAGCTATTGGCCTGGTACTGG + Intronic
1018803791 6:167242981-167243003 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1020396718 7:7725524-7725546 GACAGCTCTTGGCCTGTTACTGG + Intronic
1020437663 7:8183140-8183162 TCCAGCTCTTGGTCTCCTATGGG + Intronic
1020710350 7:11597635-11597657 GACAGCTCTTGGCCTGTTACTGG + Intronic
1020981792 7:15078119-15078141 AACATCTCTCCATCTGCTACCGG + Intergenic
1021305091 7:19022517-19022539 AATAGCTCTTGGACTGCTACTGG - Intronic
1021988810 7:26122932-26122954 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1022078886 7:27000338-27000360 CACAGCTATTGGCCTGTTACTGG + Intergenic
1024040538 7:45550154-45550176 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1024744207 7:52388453-52388475 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1025774301 7:64546176-64546198 CACAGCTCTTGATCTGAGACAGG + Intronic
1026790940 7:73331210-73331232 AACAGGTCTTGGTTTGCTCAGGG - Intronic
1027685798 7:81277964-81277986 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1028141736 7:87281993-87282015 GACAGCTCTTGGCCTGTTATTGG + Intergenic
1028237821 7:88382830-88382852 GACAGCTCTTGGCCTATTACTGG + Intergenic
1028488610 7:91386612-91386634 AACAGCTCCTTGGCTGCTGCAGG - Intergenic
1028935014 7:96455072-96455094 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1030368754 7:108674036-108674058 GACAGATCTTGGCCTGTTACTGG + Intergenic
1030457463 7:109793043-109793065 GACAACTCTTGGCCTGTTACTGG - Intergenic
1031236827 7:119188024-119188046 GACAGCTCTTGGCCTGTTACAGG + Intergenic
1031676558 7:124618373-124618395 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1032153104 7:129446949-129446971 GACAGCTCTTGGCCTGTTACTGG - Intronic
1032923470 7:136576107-136576129 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1034357254 7:150460931-150460953 AACAGCTTTTGGCCTGCCGCTGG - Intronic
1035077570 7:156191023-156191045 AACAGTTCCTGGTGTTCTACTGG - Intergenic
1035759987 8:2062062-2062084 CACAGCTCTGGGTCCTCTACTGG - Intronic
1037579953 8:20239178-20239200 ACAAGCTCTTGGTCTGCTGCTGG - Intergenic
1037953618 8:23036110-23036132 AACAGCTCTTGGCTTGTTTCTGG + Intronic
1038454464 8:27663629-27663651 AACAGCTTTTGACCTTCTACTGG - Intronic
1038875616 8:31545591-31545613 AACAGGTCCTGGTTTGCTACTGG - Intergenic
1039626542 8:39060144-39060166 AAAAACTATTGGCCTGCTACTGG - Intronic
1040030984 8:42823422-42823444 GACAGCTCTTGACCTGCTAATGG - Intergenic
1040711010 8:50188759-50188781 AACAGATTTTGGTCTGCTACAGG - Intronic
1040724965 8:50371153-50371175 ATCAGCTATTGGCCTACTACTGG + Intronic
1040726245 8:50384975-50384997 GACAGCTCTTTTTCTGCTATTGG - Intronic
1041934554 8:63321338-63321360 GACAGCTCTCGGCCTGTTACTGG + Intergenic
1042001060 8:64123988-64124010 GACAGCTCTTGGCTTGTTACGGG - Intergenic
1042342421 8:67694359-67694381 GACAGCTCTTGGCCTGCTGCTGG + Intronic
1042363774 8:67912418-67912440 AAGAGCTCATGGTCTGTTAAAGG - Intergenic
1044285973 8:90412438-90412460 GACAGCTCTTGTTCTGCTACTGG - Intergenic
1044487150 8:92767114-92767136 GACAGTTCTTGGCCTGTTACTGG - Intergenic
1045221839 8:100207073-100207095 GACAGCTCTTGGCCTGTTACTGG + Intronic
1046128673 8:109941594-109941616 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1046197558 8:110884231-110884253 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1046417637 8:113937786-113937808 GACAGGTCTTGGCCTGTTACTGG - Intergenic
1046585785 8:116147711-116147733 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1047453631 8:124989321-124989343 GATAGCTCTTGGCCTGCTACTGG + Intergenic
1047632751 8:126726047-126726069 AGCACCTCTTGGTGTGCTAATGG - Intergenic
1048642944 8:136384801-136384823 AACAGCCCTCGGCTTGCTACTGG + Intergenic
1049189104 8:141276752-141276774 CACAGGACATGGTCTGCTACAGG + Intronic
1050482675 9:6102611-6102633 GACAGCTCTTGGCCTATTACTGG + Intergenic
1050527693 9:6560420-6560442 AACGGCTGTTGGTCTCATACTGG + Intronic
1050824374 9:9926904-9926926 AACTAATCTTGGTGTGCTACAGG - Intronic
1052227590 9:26108384-26108406 GACAGCTCTTGGCCTGTTACTGG + Intronic
1052895472 9:33743610-33743632 GACAATTCTTGGTCTGCTACTGG - Intergenic
1053440342 9:38111024-38111046 AACAGGACTTGGTATACTACTGG + Intergenic
1054846926 9:69807956-69807978 AACAGCTTTAGGTCTTCTAGGGG + Intergenic
1055678621 9:78691686-78691708 AAGAGCTTTTGGCTTGCTACTGG - Intergenic
1056156667 9:83845217-83845239 GACAGCTCTTGGCCTGTTACTGG + Intronic
1056314234 9:85372937-85372959 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1056353871 9:85778310-85778332 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1056524936 9:87434161-87434183 AACAGCTCCTGACTTGCTACTGG - Intergenic
1057058997 9:91986598-91986620 AACAGCTCTTGGCCTGCTACTGG + Intergenic
1058239798 9:102542501-102542523 GACAGCTCTTAGCTTGCTACCGG + Intergenic
1058544165 9:106042742-106042764 GACAGCTCTTGGCCTATTACTGG - Intergenic
1059196505 9:112375860-112375882 GACAGCTCTTAGCCTGTTACTGG - Intergenic
1060178782 9:121517325-121517347 GACAGCTCTTGGCCTGCGGCTGG + Intergenic
1062135472 9:134925031-134925053 GACAGCTCTTGACCTGTTACAGG + Intergenic
1062476514 9:136730364-136730386 AGCAGGTCATGGTCTGCTCCGGG - Intergenic
1186279496 X:7977126-7977148 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1186384093 X:9091754-9091776 GACAGCTCTTGGCCTGTTACTGG - Intronic
1186469766 X:9812101-9812123 TAAAGCTCTTGGCCTGTTACTGG - Intronic
1186859277 X:13655554-13655576 GACAGCTCTGGTTCTGCTCCTGG - Intronic
1187604866 X:20871870-20871892 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1189032440 X:37464272-37464294 AATAGCCCTTGGCCTGCTACTGG - Intronic
1189154883 X:38746714-38746736 GACAGTTCTTGGCCTGTTACTGG - Intergenic
1189237028 X:39495018-39495040 TACAGCTCAAGGTCTGCTTCTGG - Intergenic
1190255320 X:48758146-48758168 AACAGCTCTTGGTCTGCTACTGG + Intergenic
1190507208 X:51137933-51137955 AACAGCTCTTGATATGTTTCTGG + Intergenic
1190527878 X:51346241-51346263 AATAGCTCTTGGCCTGCTACCGG - Intergenic
1190601537 X:52097827-52097849 AACAGCTCTTGGTCTGCTACTGG - Intergenic
1190721636 X:53153603-53153625 AACAGCTCTTGATCTGCTACTGG - Intergenic
1191119265 X:56886532-56886554 AACAGCTCTTGGTTCTCTGCTGG - Intergenic
1191134033 X:57044480-57044502 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1191630037 X:63312581-63312603 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1191658804 X:63629799-63629821 GACAGCTCTTGGCTTGTTACTGG - Intergenic
1191742539 X:64451301-64451323 AACAGCTATTGGCCTGTTACTGG - Intergenic
1191769494 X:64740091-64740113 GACAGCTTTTGGCCTGTTACTGG - Intergenic
1191932926 X:66394170-66394192 GACAGCTTTTGGCCTGTTACTGG + Intergenic
1191946354 X:66539018-66539040 GACTGCTCTTGGTCTGTTACTGG + Intergenic
1192253225 X:69431178-69431200 AACTGATCTTGGTCTGCTCCAGG - Intergenic
1192557244 X:72100518-72100540 AACAGGTCATGGACTGGTACGGG - Intergenic
1192824487 X:74681201-74681223 AACAGCTTTTGGCTTGCTACTGG + Intergenic
1192898704 X:75471916-75471938 GACAGCTCTTGGCCTATTACTGG + Intronic
1192996193 X:76515584-76515606 AACAGCTCTTGGCATGTTACTGG + Intergenic
1193053491 X:77125774-77125796 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1193297781 X:79852680-79852702 AACAGTTCTTGGCCTGTTACTGG + Intergenic
1193356256 X:80523129-80523151 GACAACTCTTGGCCTGTTACTGG + Intergenic
1193447157 X:81618777-81618799 GACAGCTCTTGGCCTATTACTGG + Intergenic
1193832948 X:86310103-86310125 GACAGCTCTTGACCTGTTACTGG + Intronic
1193914801 X:87351922-87351944 AACAGCTCTTGGCCTGTTACTGG - Intergenic
1193957285 X:87878216-87878238 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1194179590 X:90695929-90695951 GACAACTCTTGGCCTGTTACTGG - Intergenic
1194443550 X:93961109-93961131 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1194513417 X:94822246-94822268 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1194604389 X:95961962-95961984 GACAGCTTTTGGCCTGTTACTGG - Intergenic
1194626616 X:96233172-96233194 GACAGTTCTTGGCCTGCTACTGG + Intergenic
1194849245 X:98852168-98852190 GACAGCTCTTGGTCTGTTACTGG - Intergenic
1195228469 X:102822277-102822299 AACAGCTCTTGGCCTGCTAATGG + Intergenic
1195782352 X:108479859-108479881 GACAGCTCTTGGCCTGTTACTGG - Intronic
1196114480 X:111984119-111984141 AACAGCTCTTAGCCCGCTACTGG - Intronic
1196135968 X:112209837-112209859 GACAGCTCTTGGACTGTTACTGG - Intergenic
1197002290 X:121452930-121452952 GATAGCTCATGGTCTGTTACTGG + Intergenic
1197044415 X:121978331-121978353 GACAACTCTTGGCCTGTTACTGG + Intergenic
1197245045 X:124158988-124159010 GACAGCTCTTGGCCTGTTACTGG - Intronic
1197372055 X:125637860-125637882 GGCAGCTCTTGGCCTGTTACTGG - Intergenic
1197380000 X:125727899-125727921 GACAGCTCTTAGCCTGTTACTGG - Intergenic
1197477358 X:126941323-126941345 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1197534717 X:127673485-127673507 AAGAGCTGTTGGCCTGCTACTGG + Intergenic
1197988976 X:132296703-132296725 AAGAGCTGTTTGTCTGCTACTGG - Intergenic
1198701301 X:139400302-139400324 GACGGCTCTTGGCCTGTTACTGG + Intergenic
1198702795 X:139415715-139415737 AAAACCTCATGGTGTGCTACTGG + Intergenic
1198783039 X:140257791-140257813 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1198934041 X:141887885-141887907 GACAGCTCTTGGCCTGTTACTGG + Intronic
1199021248 X:142881107-142881129 AACAGCTCTTGGCCTGCCACTGG + Intergenic
1199024380 X:142919725-142919747 GACAGCTCTTGGACTGTTACCGG + Intergenic
1199040592 X:143111106-143111128 GACAGCTCTTGGTCTGTTACTGG + Intergenic
1199144441 X:144348959-144348981 AACAGCTCTTGGCCTGTTACTGG - Intergenic
1199310426 X:146314394-146314416 GACAGCTCTTGGCCCGTTACTGG - Intergenic
1199340334 X:146670069-146670091 AACAGCCCTTGGAGTGCTGCTGG + Intergenic
1199389657 X:147264162-147264184 AACAGGTCATGGACTGGTACTGG - Intergenic
1199580350 X:149354180-149354202 AGCAGCTCTTGCCTTGCTACTGG + Intergenic
1199997702 X:153036641-153036663 AACAGCTTCTGGTGTGCTTCTGG + Intergenic
1200289357 X:154857145-154857167 GATAGCTCTTGGCCTACTACTGG + Intronic
1200340494 X:155390636-155390658 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1200521271 Y:4212036-4212058 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1200526252 Y:4278098-4278120 GACAACTCTTGGCCTGTTACTGG - Intergenic
1200798181 Y:7361018-7361040 AACAGGCCATGGACTGCTACTGG + Intergenic
1200976630 Y:9218486-9218508 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1201748136 Y:17402979-17403001 AGCAGCTGTTGGCCTACTACTGG + Intergenic
1201798428 Y:17926705-17926727 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1201803125 Y:17979252-17979274 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1202359748 Y:24095395-24095417 GACAACTCTTGGCCTGTTACTGG + Intergenic
1202511030 Y:25574719-25574741 GACAACTCTTGGCCTGTTACTGG - Intergenic